Incidental Mutation 'R1512:Klhl24'
ID168451
Institutional Source Beutler Lab
Gene Symbol Klhl24
Ensembl Gene ENSMUSG00000062901
Gene Namekelch-like 24
Synonyms
MMRRC Submission 039559-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R1512 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location20097542-20129221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20122936 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 545 (K545E)
Ref Sequence ENSEMBL: ENSMUSP00000023509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023509]
Predicted Effect probably damaging
Transcript: ENSMUST00000023509
AA Change: K545E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023509
Gene: ENSMUSG00000062901
AA Change: K545E

DomainStartEndE-ValueType
BTB 66 163 3.49e-29 SMART
BACK 168 270 1.53e-38 SMART
Kelch 314 363 8.21e-2 SMART
Kelch 364 407 6.04e-3 SMART
Kelch 408 454 5.71e-13 SMART
Kelch 455 502 1.51e-3 SMART
Kelch 503 544 9.19e-1 SMART
Kelch 545 592 2.43e-7 SMART
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.0%
Validation Efficiency 95% (79/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitin ligase substrate receptor and is regulated by autoubiquitination. Variations in the translation initiation codon of this gene have been found, which result in an N-terminally truncated but more stable protein due to loss of the autoubiquitination function. The more stable mutant protein causes an increased ubiquitin and degradation of keratin 14, which leads to skin fragility and the potentially life-threatening disease epidermolysis bullosa. The encoded protein is also involved in the regulation of kainate receptors. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,195,469 D40E probably benign Het
Acsf2 C T 11: 94,561,398 probably benign Het
Adamts19 C T 18: 59,048,845 H1119Y possibly damaging Het
Akap6 A G 12: 52,937,154 D827G probably damaging Het
Ankrd33b T C 15: 31,367,229 D55G probably damaging Het
Ano5 T A 7: 51,579,568 H569Q probably benign Het
Aox2 A G 1: 58,307,351 D548G probably benign Het
Baz2a A G 10: 128,124,152 D1433G possibly damaging Het
BC031181 T G 18: 75,008,696 V8G probably damaging Het
Bicdl2 A T 17: 23,668,109 M457L probably damaging Het
C130074G19Rik T C 1: 184,882,906 D29G probably damaging Het
Cd200r1 A T 16: 44,766,027 T7S probably benign Het
Cdc37 A G 9: 21,142,416 probably benign Het
Cmtr2 T C 8: 110,222,635 S526P probably damaging Het
Cntn2 G T 1: 132,523,692 A433D probably damaging Het
Cntnap5a T C 1: 115,900,950 S35P probably benign Het
Csf3r A G 4: 126,029,984 T96A possibly damaging Het
Ctbs A G 3: 146,454,965 N96D probably benign Het
Cyp26b1 C A 6: 84,576,997 V213L probably benign Het
Dach1 A G 14: 97,901,399 L536P probably damaging Het
Dcaf6 T C 1: 165,352,020 Q517R probably benign Het
Dnah1 G T 14: 31,293,037 Q1733K probably damaging Het
Dnah17 A T 11: 118,095,015 I1416N probably benign Het
Dock11 G A X: 36,020,035 R1102H probably damaging Het
Dpp8 T C 9: 65,063,814 probably benign Het
Emc1 G A 4: 139,360,184 probably null Het
Emc8 A G 8: 120,658,244 L76P possibly damaging Het
Emx2 T C 19: 59,459,603 Y130H possibly damaging Het
Fbf1 C T 11: 116,147,927 R815Q probably damaging Het
Foxb2 G A 19: 16,872,514 P376L probably damaging Het
Gabrb1 C A 5: 72,108,704 L202I probably damaging Het
Gabrb1 T A 5: 72,108,705 L202Q probably damaging Het
Grin2c T A 11: 115,253,850 I617F probably damaging Het
Gtf2h3 T A 5: 124,590,870 V164E probably damaging Het
Gusb T C 5: 130,000,890 Q88R probably damaging Het
Hormad2 T A 11: 4,424,788 K75N probably damaging Het
Il33 A G 19: 29,951,990 T38A possibly damaging Het
Ivns1abp A T 1: 151,360,936 Q416L possibly damaging Het
Ivns1abp G C 1: 151,360,937 Q416H probably benign Het
Kcnh5 T A 12: 75,119,937 H178L probably benign Het
Kif21b A G 1: 136,152,805 N579S probably benign Het
Kif26a G C 12: 112,146,955 R95P possibly damaging Het
Kl A G 5: 150,988,597 I604V probably benign Het
Mcm3ap A G 10: 76,470,513 I153M probably damaging Het
Meis1 T G 11: 18,881,682 D452A probably damaging Het
Msantd4 C T 9: 4,384,138 P153L probably benign Het
Myot A G 18: 44,342,355 E181G probably damaging Het
Nf1 T C 11: 79,390,369 F150S probably damaging Het
Nyap2 T A 1: 81,241,851 S529R probably damaging Het
Olfr1145 A T 2: 87,810,644 T275S probably benign Het
Olfr1386 A G 11: 49,470,459 I103V probably benign Het
Olfr923 T A 9: 38,828,364 Y224* probably null Het
Olfr958 T C 9: 39,550,094 Y259C probably damaging Het
Pcnt C T 10: 76,404,662 probably null Het
Pik3c3 T C 18: 30,322,236 probably null Het
Pkdcc A T 17: 83,220,044 Y217F possibly damaging Het
Pnpla6 C A 8: 3,535,459 probably benign Het
Polr3gl T C 3: 96,580,874 M26V probably benign Het
Ppp1r13b T C 12: 111,872,408 N12S possibly damaging Het
Ppp1r26 G A 2: 28,451,516 R386K probably benign Het
Prdm10 A G 9: 31,337,401 E355G probably damaging Het
Prex2 T C 1: 11,061,330 F41S possibly damaging Het
Prkar1b G T 5: 139,050,673 Y231* probably null Het
Prkdc A T 16: 15,687,404 I857L probably benign Het
Psg21 A T 7: 18,656,500 N10K probably benign Het
Rapgef3 A T 15: 97,757,501 V444E probably benign Het
Rnf17 A T 14: 56,467,786 T716S probably benign Het
Rps6ka1 C T 4: 133,851,004 R577H probably damaging Het
Scn1a A C 2: 66,331,285 N306K possibly damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Ssu2 A G 6: 112,387,998 M1T probably null Het
Stag3 A T 5: 138,297,985 T437S probably benign Het
Tal2 A G 4: 53,786,107 Y96C probably benign Het
Thoc3 A T 13: 54,466,178 probably null Het
Tle1 T C 4: 72,141,258 D19G probably damaging Het
Trpm4 A G 7: 45,315,044 I690T probably benign Het
Trpm6 A T 19: 18,875,931 M1772L probably benign Het
Unc5b G A 10: 60,831,475 probably benign Het
Usf3 G T 16: 44,221,198 V2014F probably damaging Het
Utp18 C T 11: 93,885,564 A32T probably benign Het
Wdfy4 A G 14: 32,960,808 V2981A probably damaging Het
Zfp608 A G 18: 54,946,666 V349A probably damaging Het
Znfx1 A C 2: 167,056,317 I229S probably benign Het
Other mutations in Klhl24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Klhl24 APN 16 20122967 missense possibly damaging 0.78
IGL02419:Klhl24 APN 16 20107368 nonsense probably null
IGL02504:Klhl24 APN 16 20115943 nonsense probably null
IGL02799:Klhl24 UTSW 16 20114581 missense probably damaging 1.00
R1658:Klhl24 UTSW 16 20107092 nonsense probably null
R2076:Klhl24 UTSW 16 20117878 missense probably damaging 0.98
R2504:Klhl24 UTSW 16 20120167 missense probably benign 0.00
R4084:Klhl24 UTSW 16 20114562 missense probably damaging 0.98
R4299:Klhl24 UTSW 16 20107004 missense probably damaging 1.00
R4624:Klhl24 UTSW 16 20120123 missense probably damaging 1.00
R4780:Klhl24 UTSW 16 20106958 missense probably damaging 0.99
R5652:Klhl24 UTSW 16 20120247 nonsense probably null
R5827:Klhl24 UTSW 16 20120121 nonsense probably null
R6363:Klhl24 UTSW 16 20120183 missense possibly damaging 0.52
R6734:Klhl24 UTSW 16 20107529 missense probably damaging 1.00
R7069:Klhl24 UTSW 16 20107481 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTCAAACATACAACAGGAGTTGGGCA -3'
(R):5'- ATTTTGGGTCAGAAAGGCATCAGGATT -3'

Sequencing Primer
(F):5'- TGGGCAAAAGGGATATTATGTCTCC -3'
(R):5'- TGCAAAGGAGTTGAGTTCTCAC -3'
Posted On2014-04-13