Incidental Mutation 'R1644:Tmcc1'
ID173746
Institutional Source Beutler Lab
Gene Symbol Tmcc1
Ensembl Gene ENSMUSG00000030126
Gene Nametransmembrane and coiled coil domains 1
Synonyms
MMRRC Submission 039680-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R1644 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location116018611-116193486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116133865 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 156 (S156P)
Ref Sequence ENSEMBL: ENSMUSP00000133794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088896] [ENSMUST00000173031] [ENSMUST00000173110]
Predicted Effect unknown
Transcript: ENSMUST00000032222
AA Change: S152P
SMART Domains Protein: ENSMUSP00000032222
Gene: ENSMUSG00000030126
AA Change: S152P

DomainStartEndE-ValueType
low complexity region 153 164 N/A INTRINSIC
Pfam:Tmemb_cc2 268 677 9.7e-170 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088896
AA Change: S156P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086285
Gene: ENSMUSG00000030126
AA Change: S156P

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Pfam:Tmemb_cc2 227 636 2.3e-170 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000172909
AA Change: S13P
SMART Domains Protein: ENSMUSP00000134407
Gene: ENSMUSG00000030126
AA Change: S13P

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173031
AA Change: S156P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134148
Gene: ENSMUSG00000030126
AA Change: S156P

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173110
AA Change: S156P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133794
Gene: ENSMUSG00000030126
AA Change: S156P

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204637
Meta Mutation Damage Score 0.416 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,414,590 R8* probably null Het
Acacb A T 5: 114,195,285 H490L probably damaging Het
Ace C A 11: 105,985,106 H417N probably damaging Het
Adamtsl3 A G 7: 82,450,090 N151D possibly damaging Het
Agap1 A G 1: 89,663,730 N114S probably damaging Het
Arap3 A T 18: 37,984,245 V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 I8N probably benign Het
Arhgef17 A T 7: 100,929,504 F746I probably damaging Het
Atp6v0a1 T C 11: 101,038,786 S471P possibly damaging Het
Bdp1 A G 13: 100,060,940 V979A probably benign Het
Ccdc88c C A 12: 100,913,474 R1789L probably damaging Het
Cckar A T 5: 53,699,873 N327K probably benign Het
Cfap65 T C 1: 74,917,175 T1082A probably damaging Het
Clcn7 T A 17: 25,159,698 I719N probably damaging Het
Col27a1 C G 4: 63,328,631 probably benign Het
Cspp1 C T 1: 10,126,438 T179I probably damaging Het
Dnah1 C T 14: 31,302,292 probably benign Het
Dnah6 A G 6: 73,155,296 V1141A probably benign Het
Dusp4 A G 8: 34,818,479 Y298C probably damaging Het
Efhc1 C A 1: 20,967,401 Y267* probably null Het
Eif2s1 T A 12: 78,866,521 probably null Het
Epo A G 5: 137,483,155 V169A possibly damaging Het
Esr1 A T 10: 5,001,380 Y586F probably benign Het
Fat2 T C 11: 55,287,783 T1484A possibly damaging Het
Fat2 T C 11: 55,296,181 T1280A possibly damaging Het
Gm5828 T C 1: 16,769,261 noncoding transcript Het
Idh3b T C 2: 130,281,510 I187V possibly damaging Het
Kif13a A C 13: 46,793,922 V862G probably benign Het
Kndc1 A G 7: 139,930,756 D1327G probably damaging Het
Mfsd9 T A 1: 40,773,798 R452S probably benign Het
Myh15 C T 16: 49,132,203 R879C probably benign Het
Naip2 T C 13: 100,182,929 R260G possibly damaging Het
Npat T G 9: 53,570,172 L1060R probably damaging Het
Olfr1211 A T 2: 88,929,387 D309E probably benign Het
Olfr1261 A T 2: 89,993,953 T187S possibly damaging Het
Olfr169 T A 16: 19,566,406 H159L probably benign Het
Olfr523 T C 7: 140,176,648 V176A probably benign Het
Olfr667 A C 7: 104,916,808 F163V probably benign Het
Pld5 T C 1: 175,975,626 T296A possibly damaging Het
Polq C T 16: 37,060,264 A651V probably damaging Het
Polr3a G A 14: 24,470,624 P607S probably damaging Het
Ranbp9 G A 13: 43,412,539 R424C probably damaging Het
Rsl1 G A 13: 67,177,165 probably benign Het
Sema4c A G 1: 36,550,804 S490P probably damaging Het
Setd3 A T 12: 108,113,344 L300Q possibly damaging Het
Slc15a3 T C 19: 10,857,231 I492T possibly damaging Het
Stag1 T C 9: 100,880,900 probably benign Het
Tgm4 A G 9: 123,051,416 Y294C probably damaging Het
Tm9sf1 A G 14: 55,641,300 S212P probably benign Het
Vmn1r184 A C 7: 26,267,245 M139L probably benign Het
Vmn1r209 A C 13: 22,806,482 F13V possibly damaging Het
Xkr5 T C 8: 18,934,125 E467G probably benign Het
Zdbf2 C T 1: 63,308,972 S2170L possibly damaging Het
Zfp277 G T 12: 40,329,610 probably null Het
Zfp62 T C 11: 49,215,769 I229T probably damaging Het
Zfp810 A G 9: 22,279,028 S195P possibly damaging Het
Zfp94 G A 7: 24,311,502 probably benign Het
Other mutations in Tmcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Tmcc1 APN 6 116043027 missense probably damaging 0.99
IGL01580:Tmcc1 APN 6 116042985 missense possibly damaging 0.91
IGL02858:Tmcc1 APN 6 116133888 missense probably damaging 0.99
IGL03226:Tmcc1 APN 6 116133976 missense probably damaging 0.99
FR4976:Tmcc1 UTSW 6 116193380 start gained probably benign
IGL02988:Tmcc1 UTSW 6 116042928 missense probably damaging 1.00
R0522:Tmcc1 UTSW 6 116042870 frame shift probably null
R0654:Tmcc1 UTSW 6 116042990 missense probably benign 0.03
R0721:Tmcc1 UTSW 6 116042870 frame shift probably null
R1392:Tmcc1 UTSW 6 116022110 missense possibly damaging 0.84
R1573:Tmcc1 UTSW 6 116133963 missense probably damaging 0.99
R2062:Tmcc1 UTSW 6 116043058 missense probably benign 0.01
R2065:Tmcc1 UTSW 6 116042870 frame shift probably null
R2214:Tmcc1 UTSW 6 116042870 frame shift probably null
R2240:Tmcc1 UTSW 6 116042870 frame shift probably null
R2399:Tmcc1 UTSW 6 116042870 frame shift probably null
R3683:Tmcc1 UTSW 6 116042870 frame shift probably null
R3722:Tmcc1 UTSW 6 116133822 missense possibly damaging 0.83
R3926:Tmcc1 UTSW 6 116042913 missense probably damaging 1.00
R4082:Tmcc1 UTSW 6 116043480 missense probably damaging 1.00
R4155:Tmcc1 UTSW 6 116133804 missense probably benign 0.18
R4619:Tmcc1 UTSW 6 116043286 missense probably damaging 1.00
R5246:Tmcc1 UTSW 6 116043420 missense probably damaging 1.00
R5568:Tmcc1 UTSW 6 116022110 missense possibly damaging 0.84
R6364:Tmcc1 UTSW 6 116043761 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGAACCTCCAATGATCAACATCC -3'
(R):5'- TCTCCAGCAGATCCGAGTGCC -3'

Sequencing Primer
(F):5'- ccttccccttccaagcac -3'
(R):5'- CGAGTGCCACCCAAGATG -3'
Posted On2014-04-24