Incidental Mutation 'R1649:Lsamp'
ID174132
Institutional Source Beutler Lab
Gene Symbol Lsamp
Ensembl Gene ENSMUSG00000061080
Gene Namelimbic system-associated membrane protein
SynonymsLamp, D930023J12Rik, Lam, B130007O04Rik
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R1649 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location39984361-42181679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41955298 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 171 (M171L)
Ref Sequence ENSEMBL: ENSMUSP00000139667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078873] [ENSMUST00000099761] [ENSMUST00000187695]
Predicted Effect probably benign
Transcript: ENSMUST00000078873
AA Change: M154L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077913
Gene: ENSMUSG00000061080
AA Change: M154L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 129 1.81e-10 SMART
IGc2 144 204 3.7e-16 SMART
IGc2 230 297 2.12e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099761
AA Change: M154L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097349
Gene: ENSMUSG00000061080
AA Change: M154L

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
IG 38 129 1.81e-10 SMART
IGc2 144 204 3.7e-16 SMART
IGc2 230 297 2.12e-16 SMART
transmembrane domain 313 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187695
AA Change: M171L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139667
Gene: ENSMUSG00000061080
AA Change: M171L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 55 146 7.6e-13 SMART
IGc2 161 221 1.5e-18 SMART
IGc2 247 314 8.6e-19 SMART
transmembrane domain 330 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin LAMP, OBCAM and neurotrimin (IgLON) family of proteins. The encoded preproprotein is proteolytically processed to generate a neuronal surface glycoprotein. This protein may act as a selective homophilic adhesion molecule during axon guidance and neuronal growth in the developing limbic system. The encoded protein may also function as a tumor suppressor and may play a role in neuropsychiatric disorders. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for mutations in this gene are hyperresponsive to novel environments. Mice homozygous for another knock-out allele exhibit reduced barbering, whisker trimming, anxiety, dominance, and aggression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Lsamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01665:Lsamp APN 16 42144012 nonsense probably null
IGL02869:Lsamp APN 16 42144715 missense probably benign 0.00
R0930:Lsamp UTSW 16 41888964 missense probably benign 0.25
R1147:Lsamp UTSW 16 42174136 splice site probably benign
R1170:Lsamp UTSW 16 42151229 intron probably benign
R1656:Lsamp UTSW 16 41955319 missense probably damaging 1.00
R1976:Lsamp UTSW 16 41889067 missense probably damaging 0.99
R3613:Lsamp UTSW 16 41955323 missense probably benign 0.03
R3732:Lsamp UTSW 16 42144572 missense probably damaging 1.00
R3734:Lsamp UTSW 16 42144770 missense probably benign
R3838:Lsamp UTSW 16 42134312 missense possibly damaging 0.54
R3890:Lsamp UTSW 16 39984692 missense probably benign 0.01
R3891:Lsamp UTSW 16 39984692 missense probably benign 0.01
R4554:Lsamp UTSW 16 42144075 missense probably damaging 1.00
R4672:Lsamp UTSW 16 41955334 missense probably damaging 1.00
R5151:Lsamp UTSW 16 42134429 missense probably damaging 1.00
R5617:Lsamp UTSW 16 42134423 missense probably damaging 1.00
R6075:Lsamp UTSW 16 42134425 missense probably benign 0.19
R6217:Lsamp UTSW 16 42134312 missense possibly damaging 0.54
R6477:Lsamp UTSW 16 42168165 intron probably benign
R6637:Lsamp UTSW 16 41533381 missense possibly damaging 0.86
X0024:Lsamp UTSW 16 42144558 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACCCTTCATAGCACACCTGACTTTTATTATAC -3'
(R):5'- AGCCAAAATTATGGGAACTCTACACAACATT -3'

Sequencing Primer
(F):5'- ACAGTATCCTGGCTACTTAGCAG -3'
(R):5'- GGGAACTCTACACAACATTTATACTG -3'
Posted On2014-04-24