Incidental Mutation 'R1598:Ubr7'
Institutional Source Beutler Lab
Gene Symbol Ubr7
Ensembl Gene ENSMUSG00000041712
Gene Nameubiquitin protein ligase E3 component n-recognin 7 (putative)
MMRRC Submission 039635-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R1598 (G1)
Quality Score225
Status Not validated
Chromosomal Location102757967-102777707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102769894 bp
Amino Acid Change Methionine to Isoleucine at position 358 (M358I)
Ref Sequence ENSEMBL: ENSMUSP00000041247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046404]
Predicted Effect probably damaging
Transcript: ENSMUST00000046404
AA Change: M358I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041247
Gene: ENSMUSG00000041712
AA Change: M358I

low complexity region 13 33 N/A INTRINSIC
Pfam:zf-UBR 45 113 2.4e-15 PFAM
PHD 134 186 1.78e-1 SMART
low complexity region 261 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a UBR box-containing protein that belongs to the E3 ubiquitin ligase family. The protein also contains a plant homeodomain (PHD) in the C-terminus. In mammals, the encoded protein recognizes N-degrons, the destabilizing N-terminal residues of short-lived proteins, which results in ubiquitinylation, and proteolysis via the proteasome. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G A 11: 80,364,012 Q328* probably null Het
Adamts1 G A 16: 85,798,511 Q260* probably null Het
Add2 A T 6: 86,098,646 Y259F probably benign Het
Bora T C 14: 99,068,404 V403A probably benign Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Ccnl1 G A 3: 65,946,770 R477W probably damaging Het
Cdc25a CG CGG 9: 109,879,893 probably null Het
Cdr2l T C 11: 115,393,377 S180P probably damaging Het
Cep290 T A 10: 100,549,329 L1889Q probably damaging Het
Ces4a T C 8: 105,142,821 V208A probably damaging Het
Col2a1 T C 15: 97,979,250 D1049G probably damaging Het
Coro1a A T 7: 126,701,692 N154K possibly damaging Het
Cubn T A 2: 13,469,789 R401S probably benign Het
Cul7 A T 17: 46,663,091 Q1434L probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dars G T 1: 128,373,972 D308E probably benign Het
Dna2 T A 10: 62,961,657 F604I probably damaging Het
Dnah1 T G 14: 31,301,262 I1033L probably benign Het
Dusp27 G A 1: 166,110,259 T77I probably benign Het
Erlin1 T C 19: 44,047,673 E206G probably damaging Het
Esrp2 T A 8: 106,133,273 E345D probably damaging Het
Foxa1 T C 12: 57,542,687 D249G possibly damaging Het
Ghsr C A 3: 27,372,277 L161M probably benign Het
Gm436 T A 4: 144,670,424 K246I possibly damaging Het
Gpr155 C A 2: 73,370,090 V358F probably damaging Het
H2-Eb2 A T 17: 34,334,374 N178I probably damaging Het
Hydin T A 8: 110,410,674 I703N possibly damaging Het
Kctd15 A G 7: 34,641,992 V170A probably damaging Het
Klhl31 A T 9: 77,651,016 Y338F possibly damaging Het
Krt5 C T 15: 101,712,441 A124T probably benign Het
Krt72 T A 15: 101,780,253 I331F probably benign Het
Lrp1b T A 2: 41,511,478 D388V probably damaging Het
Ly9 A G 1: 171,596,507 V382A probably benign Het
Mon2 T C 10: 123,016,396 Y1024C probably damaging Het
Myh14 A G 7: 44,638,394 F572L probably damaging Het
Myh3 A T 11: 67,093,171 D987V probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nphp4 A G 4: 152,562,090 T1360A probably benign Het
Olfr1034 C T 2: 86,047,313 T277I probably damaging Het
Olfr1151 T A 2: 87,857,751 I192K probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Oog4 A G 4: 143,438,001 L320P probably damaging Het
Pcnx2 T C 8: 125,772,086 N1558S probably benign Het
Pde10a A G 17: 8,929,144 E147G probably damaging Het
Pgbd5 T A 8: 124,374,287 H410L probably benign Het
Plce1 A C 19: 38,720,996 D1098A probably damaging Het
Psg25 G A 7: 18,532,003 Q16* probably null Het
Psmd9 T A 5: 123,241,917 V133E probably damaging Het
Rabgap1 C T 2: 37,561,899 S937F probably damaging Het
Rbck1 A G 2: 152,323,170 probably null Het
Rprd2 C G 3: 95,818,739 probably benign Het
Rrs1 A G 1: 9,545,912 N130S probably benign Het
Scmh1 A T 4: 120,515,130 I377F possibly damaging Het
Skor1 G T 9: 63,146,004 R228S probably damaging Het
Slc2a4 A G 11: 69,945,018 V335A probably benign Het
Slc4a9 G A 18: 36,528,371 W62* probably null Het
Taar9 G T 10: 24,109,407 A43D possibly damaging Het
Tns4 T C 11: 99,070,417 Y645C probably damaging Het
Tpcn2 G T 7: 145,277,220 Y129* probably null Het
Trpm3 T C 19: 22,733,024 S278P possibly damaging Het
Ttc3 T C 16: 94,422,297 W615R probably damaging Het
Ttll5 T C 12: 85,863,598 V207A probably damaging Het
Urb1 C A 16: 90,777,440 V918F possibly damaging Het
Vmn2r51 G A 7: 10,105,505 T52I probably benign Het
Vmn2r95 A T 17: 18,452,313 I771F probably benign Het
Wfdc16 T C 2: 164,635,430 S107G probably benign Het
Zmym2 A G 14: 56,902,769 T22A possibly damaging Het
Zmym2 G A 14: 56,914,067 G470R probably damaging Het
Other mutations in Ubr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Ubr7 APN 12 102768276 nonsense probably null
IGL02493:Ubr7 APN 12 102768220 missense probably benign 0.00
IGL02750:Ubr7 APN 12 102771278 missense possibly damaging 0.68
IGL03229:Ubr7 APN 12 102769155 missense probably damaging 1.00
dwindled UTSW 12 102761464 missense probably damaging 1.00
R0519:Ubr7 UTSW 12 102768206 missense probably benign 0.00
R0894:Ubr7 UTSW 12 102769191 missense probably damaging 1.00
R1453:Ubr7 UTSW 12 102769178 missense probably benign 0.00
R2201:Ubr7 UTSW 12 102761505 critical splice donor site probably null
R4731:Ubr7 UTSW 12 102769226 missense probably benign 0.03
R4834:Ubr7 UTSW 12 102761502 missense probably damaging 1.00
R5222:Ubr7 UTSW 12 102775705 missense probably benign 0.09
R5662:Ubr7 UTSW 12 102768267 missense probably benign 0.00
R5845:Ubr7 UTSW 12 102766312 missense probably damaging 0.99
R5867:Ubr7 UTSW 12 102761494 missense probably damaging 1.00
R6257:Ubr7 UTSW 12 102765840 nonsense probably null
R6543:Ubr7 UTSW 12 102768235 missense probably benign 0.01
R6601:Ubr7 UTSW 12 102761464 missense probably damaging 1.00
R6849:Ubr7 UTSW 12 102758083 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agacacacaagaagagagcac -3'
(R):5'- aaacttacaaaaatcctcctgcc -3'
Posted On2014-04-24