Incidental Mutation 'R1403:Lingo2'
ID188598
Institutional Source Beutler Lab
Gene Symbol Lingo2
Ensembl Gene ENSMUSG00000045083
Gene Nameleucine rich repeat and Ig domain containing 2
SynonymsLrrn6c, LERN3, B230217C06Rik
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location35706647-36951747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35709420 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 187 (C187S)
Ref Sequence ENSEMBL: ENSMUSP00000130423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065173] [ENSMUST00000098151] [ENSMUST00000108122] [ENSMUST00000108124] [ENSMUST00000164772]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065173
AA Change: C187S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069772
Gene: ENSMUSG00000045083
AA Change: C187S

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098151
AA Change: C187S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095754
Gene: ENSMUSG00000045083
AA Change: C187S

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108122
AA Change: C187S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103757
Gene: ENSMUSG00000045083
AA Change: C187S

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108124
AA Change: C187S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103759
Gene: ENSMUSG00000045083
AA Change: C187S

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164772
AA Change: C187S

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130423
Gene: ENSMUSG00000045083
AA Change: C187S

DomainStartEndE-ValueType
LRRNT 27 61 1.86e-4 SMART
LRR 80 103 5.89e1 SMART
LRR_TYP 104 127 8.22e-2 SMART
LRR 128 151 6.57e-1 SMART
LRR 152 175 1.31e0 SMART
LRR 176 199 4.83e0 SMART
LRR 200 223 1.62e2 SMART
low complexity region 249 263 N/A INTRINSIC
LRR 272 295 2.17e-1 SMART
LRR 296 319 8.01e0 SMART
LRR_TYP 320 343 7.15e-2 SMART
LRRCT 355 408 3.7e-2 SMART
IGc2 423 490 9.99e-13 SMART
transmembrane domain 543 565 N/A INTRINSIC
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Lingo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01861:Lingo2 APN 4 35709526 missense probably benign 0.31
IGL02532:Lingo2 APN 4 35709171 missense possibly damaging 0.69
IGL02999:Lingo2 APN 4 35708744 missense probably damaging 1.00
R0077:Lingo2 UTSW 4 35708375 missense possibly damaging 0.51
R0669:Lingo2 UTSW 4 35709120 missense probably benign 0.00
R1195:Lingo2 UTSW 4 35708538 missense probably damaging 1.00
R1195:Lingo2 UTSW 4 35708538 missense probably damaging 1.00
R1195:Lingo2 UTSW 4 35708538 missense probably damaging 1.00
R1403:Lingo2 UTSW 4 35709420 missense possibly damaging 0.83
R1552:Lingo2 UTSW 4 35708315 missense probably damaging 0.99
R2066:Lingo2 UTSW 4 35709179 missense probably benign
R4207:Lingo2 UTSW 4 35709810 missense probably benign 0.01
R4208:Lingo2 UTSW 4 35709810 missense probably benign 0.01
R4326:Lingo2 UTSW 4 35708462 missense probably damaging 1.00
R4327:Lingo2 UTSW 4 35708462 missense probably damaging 1.00
R4328:Lingo2 UTSW 4 35708462 missense probably damaging 1.00
R4474:Lingo2 UTSW 4 35708810 missense probably benign
R6801:Lingo2 UTSW 4 35709566 missense probably damaging 0.97
R7343:Lingo2 UTSW 4 35709450 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTGGCTGGCATCAAATCCAACAAAG -3'
(R):5'- CCCAGAAGGCATTCCCATTGAGAC -3'

Sequencing Primer
(F):5'- ACAAAGGCCAATAGTCGATCTC -3'
(R):5'- GCCTGGGGCATTTAACAATC -3'
Posted On2014-05-09