Incidental Mutation 'R1403:Olfr483'
ID188611
Institutional Source Beutler Lab
Gene Symbol Olfr483
Ensembl Gene ENSMUSG00000078118
Gene Nameolfactory receptor 483
SynonymsMOR204-12, GA_x6K02T2PBJ9-10432095-10433042
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1403 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108100849-108105944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108103615 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 102 (I102N)
Ref Sequence ENSEMBL: ENSMUSP00000150898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104917] [ENSMUST00000215159]
Predicted Effect probably benign
Transcript: ENSMUST00000104917
AA Change: I102N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000100517
Gene: ENSMUSG00000078118
AA Change: I102N

DomainStartEndE-ValueType
Pfam:7tm_4 34 312 1.6e-51 PFAM
Pfam:7tm_1 44 294 2.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209740
AA Change: I102N
Predicted Effect probably benign
Transcript: ENSMUST00000215159
AA Change: I102N

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,059,253 probably benign Het
AC238840.3 T G 7: 38,867,921 I28L probably benign Het
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Akt3 C T 1: 177,131,110 probably benign Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdc42se2 A G 11: 54,720,366 probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Ell T A 8: 70,591,488 probably benign Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm9797 C A 10: 11,609,550 noncoding transcript Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Kdm7a C A 6: 39,151,253 probably benign Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Mterf3 A G 13: 66,929,880 probably benign Het
Neurl1a C A 19: 47,253,711 N414K probably damaging Het
Nfkbiz A G 16: 55,816,470 probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Nsmce1 A G 7: 125,467,855 probably benign Het
Prl7d1 A T 13: 27,709,197 F243I possibly damaging Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf126 C T 10: 79,760,868 A239T probably benign Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Syt15 C A 14: 34,221,202 probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vps13b A G 15: 35,709,122 probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Olfr483
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr483 APN 7 108103644 missense probably benign
IGL03028:Olfr483 APN 7 108104173 missense probably damaging 0.99
IGL03275:Olfr483 APN 7 108103608 missense probably damaging 1.00
R0671:Olfr483 UTSW 7 108104156 nonsense probably null
R1403:Olfr483 UTSW 7 108103615 missense probably benign 0.06
R1646:Olfr483 UTSW 7 108103591 missense probably benign 0.03
R1655:Olfr483 UTSW 7 108103464 missense probably damaging 1.00
R2334:Olfr483 UTSW 7 108103348 missense probably benign 0.02
R2904:Olfr483 UTSW 7 108103599 missense probably benign 0.12
R3816:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R3817:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R3818:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R3819:Olfr483 UTSW 7 108103498 missense possibly damaging 0.90
R5828:Olfr483 UTSW 7 108103798 missense possibly damaging 0.51
R5949:Olfr483 UTSW 7 108104197 missense probably damaging 1.00
R6120:Olfr483 UTSW 7 108104133 missense probably damaging 1.00
R6143:Olfr483 UTSW 7 108104128 missense probably damaging 0.96
R6505:Olfr483 UTSW 7 108103567 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTTGGCAACCTCAGCACCATC -3'
(R):5'- CACCTTGTTCTGGTCTGTGGAGAAG -3'

Sequencing Primer
(F):5'- GCACCATCCTTCTCATCAGAG -3'
(R):5'- CGATTCTATTTGGCCCACAGAAG -3'
Posted On2014-05-09