Incidental Mutation 'R1653:Gcnt3'
ID188864
Institutional Source Beutler Lab
Gene Symbol Gcnt3
Ensembl Gene ENSMUSG00000032226
Gene Nameglucosaminyl (N-acetyl) transferase 3, mucin type
Synonyms2010013H22Rik, 2210021I22Rik, 2210401J11Rik
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1653 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location70031496-70038088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70035077 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 70 (C70R)
Ref Sequence ENSEMBL: ENSMUSP00000034751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034751]
Predicted Effect probably damaging
Transcript: ENSMUST00000034751
AA Change: C70R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034751
Gene: ENSMUSG00000032226
AA Change: C70R

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Branch 133 401 2.1e-63 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the N-acetylglucosaminyltransferase family. The encoded protein is a beta-6-N-acetylglucosamine-transferase that catalyzes the formation of core 2 and core 4 O-glycans on mucin-type glycoproteins.[provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygote null mice have decreases in core 2 O-glycan structures on cell surfaces, decreased immunoglobulin levels, and disrupted mucosal barrier in the intestines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Gcnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Gcnt3 APN 9 70034457 missense probably benign 0.20
IGL02617:Gcnt3 APN 9 70034162 missense probably damaging 1.00
IGL02965:Gcnt3 APN 9 70034953 missense probably benign 0.00
IGL03113:Gcnt3 APN 9 70034701 missense probably damaging 1.00
IGL03374:Gcnt3 APN 9 70034413 missense possibly damaging 0.89
PIT4131001:Gcnt3 UTSW 9 70034044 missense possibly damaging 0.80
R0012:Gcnt3 UTSW 9 70034085 missense probably benign 0.04
R0012:Gcnt3 UTSW 9 70034085 missense probably benign 0.04
R1241:Gcnt3 UTSW 9 70034333 missense probably benign 0.01
R1662:Gcnt3 UTSW 9 70034377 missense probably benign 0.00
R2213:Gcnt3 UTSW 9 70034707 missense probably benign 0.16
R4588:Gcnt3 UTSW 9 70034230 missense probably damaging 1.00
R4927:Gcnt3 UTSW 9 70035182 missense probably damaging 1.00
R5407:Gcnt3 UTSW 9 70034189 missense probably benign 0.00
R5718:Gcnt3 UTSW 9 70034270 missense probably benign 0.00
R6974:Gcnt3 UTSW 9 70034887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACAGCTCGCAGCAACCTTTCG -3'
(R):5'- TTCTGTTCAGAGAACCCACTGCCC -3'

Sequencing Primer
(F):5'- GGAAGCTGGCCTCTTCCTTG -3'
(R):5'- CGCCTGTGAAGATGACTTCC -3'
Posted On2014-05-09