Incidental Mutation 'R0077:Rbms1'
ID19451
Institutional Source Beutler Lab
Gene Symbol Rbms1
Ensembl Gene ENSMUSG00000026970
Gene NameRNA binding motif, single stranded interacting protein 1
SynonymsMSSP-1, 2600014B10Rik, YC1, MSSP-2, MSSP-3
MMRRC Submission 038364-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0077 (G1)
Quality Score211
Status Validated
Chromosome2
Chromosomal Location60750193-60963192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60758835 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 287 (M287K)
Ref Sequence ENSEMBL: ENSMUSP00000108128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028347] [ENSMUST00000112509] [ENSMUST00000164147]
Predicted Effect probably benign
Transcript: ENSMUST00000028347
AA Change: M304K

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000028347
Gene: ENSMUSG00000026970
AA Change: M304K

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 36 54 N/A INTRINSIC
RRM 63 131 4.56e-18 SMART
RRM 142 213 2.43e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112509
AA Change: M287K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108128
Gene: ENSMUSG00000026970
AA Change: M287K

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
RRM 30 98 4.56e-18 SMART
RRM 109 180 2.43e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153555
Predicted Effect probably benign
Transcript: ENSMUST00000164147
AA Change: M318K

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131306
Gene: ENSMUSG00000026970
AA Change: M318K

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
RRM 61 129 4.56e-18 SMART
RRM 140 211 2.43e-13 SMART
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.5%
Validation Efficiency 83% (159/192)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of proteins which bind single stranded DNA/RNA. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. Several transcript variants, resulting from alternative splicing and encoding different isoforms, have been described. A pseudogene for this locus is found on chromosome 12. [provided by RefSeq, Feb 2009]
PHENOTYPE: Only about half the expected number of mice homozygous for disruptions in this gene are produced in matings of heterozygotes. Embryo sizes are reduced. Females have smaller than normal uteri and decreased levels of progesterone during estrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,771,685 probably benign Het
Adgrl4 A G 3: 151,517,781 I624V probably damaging Het
AI661453 A G 17: 47,469,362 probably benign Het
Alg12 C T 15: 88,815,978 E60K probably damaging Het
Angel2 A T 1: 190,933,087 N72Y possibly damaging Het
Ank1 C A 8: 23,140,167 P81Q probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Bpi T A 2: 158,261,334 M83K probably damaging Het
Capn7 A G 14: 31,368,115 I642V probably benign Het
Ccdc134 T C 15: 82,131,737 probably benign Het
Ccr3 C T 9: 124,029,024 T132I probably damaging Het
Cfap65 C A 1: 74,931,918 W80C probably damaging Het
Chaf1a T A 17: 56,047,384 I218K unknown Het
Ddx23 A G 15: 98,656,600 probably null Het
Dmkn A G 7: 30,765,294 S231G probably benign Het
Ep300 T C 15: 81,641,313 I1446T unknown Het
Fmnl1 T C 11: 103,189,969 F318S probably damaging Het
Grik5 A T 7: 25,023,380 V497E probably damaging Het
Gtf2ird2 T C 5: 134,214,083 Y380H probably damaging Het
Hecw2 C T 1: 53,868,831 probably benign Het
Hspb7 A G 4: 141,424,047 I167V probably damaging Het
Kcnh2 T A 5: 24,322,702 N884I probably benign Het
Krba1 T C 6: 48,405,225 probably benign Het
Krt18 G T 15: 102,030,974 R294L probably benign Het
Lctl T A 9: 64,122,107 M1K probably null Het
Lingo2 G A 4: 35,708,375 S535F possibly damaging Het
Lrba A C 3: 86,542,688 N2105H probably damaging Het
Lrrc10 A G 10: 117,045,514 D31G probably damaging Het
Lrrtm1 T A 6: 77,243,872 V104E probably damaging Het
Mgat3 C T 15: 80,212,577 T535I probably benign Het
Nav3 T C 10: 109,716,642 I1780V possibly damaging Het
Nlrc4 A G 17: 74,446,831 W186R probably damaging Het
Nr2c1 T A 10: 94,188,255 F441I probably benign Het
Obscn A G 11: 59,051,521 probably benign Het
Olfr221 T C 14: 52,035,985 N42S possibly damaging Het
Olfr444 T C 6: 42,955,773 S92P probably benign Het
Olfr59 T C 11: 74,288,675 F10L probably benign Het
Olfr688 T C 7: 105,288,519 V142A probably damaging Het
Osr1 A T 12: 9,579,691 Y188F probably damaging Het
Pak2 A T 16: 32,033,843 N293K possibly damaging Het
Pappa A T 4: 65,307,812 T1301S probably damaging Het
Pde4dip G A 3: 97,753,126 Q679* probably null Het
Pik3r5 T A 11: 68,486,622 probably null Het
Plbd2 C T 5: 120,486,039 probably null Het
Ppp1r3a G T 6: 14,754,517 P244T possibly damaging Het
Pum1 C A 4: 130,772,674 R960S probably benign Het
Ralgapb T C 2: 158,473,249 Y845H probably damaging Het
Rdh1 A T 10: 127,760,037 I34F probably damaging Het
Rgl3 T A 9: 21,974,102 Q644L probably benign Het
Rpap2 T C 5: 107,620,474 S393P probably damaging Het
Rsad2 T C 12: 26,456,377 S15G probably damaging Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
S100a11 A C 3: 93,524,202 probably null Het
Sept4 T C 11: 87,581,196 S11P probably benign Het
Serpina1c T C 12: 103,896,091 S322G probably benign Het
Setdb1 A T 3: 95,341,451 C385S probably damaging Het
Shank2 A T 7: 144,192,467 I193F possibly damaging Het
Slc4a11 G T 2: 130,686,301 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tbcd C A 11: 121,594,274 Q761K probably benign Het
Tmed6 C T 8: 107,065,566 V16M probably damaging Het
Tmem229a T C 6: 24,955,702 T18A probably benign Het
Tsc1 T A 2: 28,678,943 probably benign Het
Ube2m T C 7: 13,035,730 N49D probably damaging Het
Ubqlnl T C 7: 104,150,047 D81G probably damaging Het
Vmn2r56 A G 7: 12,715,405 V302A probably benign Het
Vmn2r73 T A 7: 85,875,867 R24S probably benign Het
Wfs1 C A 5: 36,973,194 S236I probably damaging Het
Xpot A T 10: 121,605,639 N560K probably benign Het
Yipf3 A G 17: 46,251,577 T303A probably benign Het
Zfp790 T C 7: 29,824,875 W19R probably damaging Het
Zfp846 T C 9: 20,594,007 C388R probably benign Het
Zpr1 T A 9: 46,273,336 I47N probably damaging Het
Other mutations in Rbms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Rbms1 APN 2 60797705 missense probably damaging 1.00
IGL01131:Rbms1 APN 2 60758836 missense probably benign 0.00
IGL02565:Rbms1 APN 2 60759779 missense probably benign
IGL02662:Rbms1 APN 2 60762306 missense probably damaging 1.00
ANU74:Rbms1 UTSW 2 60797716 missense probably damaging 1.00
R0279:Rbms1 UTSW 2 60842410 missense probably damaging 0.99
R0718:Rbms1 UTSW 2 60842412 missense probably damaging 0.99
R1582:Rbms1 UTSW 2 60758835 missense possibly damaging 0.48
R2151:Rbms1 UTSW 2 60762048 splice site probably null
R4812:Rbms1 UTSW 2 60792769 missense possibly damaging 0.74
R5109:Rbms1 UTSW 2 60781940 missense probably damaging 1.00
R6925:Rbms1 UTSW 2 60762304 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGGAATCCTACTGACCTGCCCTG -3'
(R):5'- TGCACTGAGAGGGCTAGTGTCTAAC -3'

Sequencing Primer
(F):5'- CTGCCCTGAGCAGAGAAG -3'
(R):5'- tgccttaccctcattgctc -3'
Posted On2013-04-11