Incidental Mutation 'R1772:Sirpa'
ID196660
Institutional Source Beutler Lab
Gene Symbol Sirpa
Ensembl Gene ENSMUSG00000037902
Gene Namesignal-regulatory protein alpha
SynonymsSIRP, Ptpns1, CD172a, P84, SHPS-1, Bit
MMRRC Submission 039803-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1772 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location129592835-129632228 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129616456 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 331 (T331A)
Ref Sequence ENSEMBL: ENSMUSP00000137611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049262] [ENSMUST00000099113] [ENSMUST00000103202] [ENSMUST00000103203] [ENSMUST00000153491] [ENSMUST00000160276] [ENSMUST00000161620] [ENSMUST00000163034] [ENSMUST00000179001]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049262
AA Change: T331A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049022
Gene: ENSMUSG00000037902
AA Change: T331A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099113
SMART Domains Protein: ENSMUSP00000096713
Gene: ENSMUSG00000037902

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 228 240 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103202
AA Change: T331A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099491
Gene: ENSMUSG00000037902
AA Change: T331A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103203
AA Change: T331A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099492
Gene: ENSMUSG00000037902
AA Change: T331A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153491
SMART Domains Protein: ENSMUSP00000120324
Gene: ENSMUSG00000037902

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160276
SMART Domains Protein: ENSMUSP00000125004
Gene: ENSMUSG00000037902

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 224 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160952
Predicted Effect possibly damaging
Transcript: ENSMUST00000161620
AA Change: T331A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124048
Gene: ENSMUSG00000037902
AA Change: T331A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162764
Predicted Effect probably benign
Transcript: ENSMUST00000163034
SMART Domains Protein: ENSMUSP00000124888
Gene: ENSMUSG00000037902

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 37 59 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179001
AA Change: T331A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137611
Gene: ENSMUSG00000037902
AA Change: T331A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 40 146 1.78e-9 SMART
IGc1 166 239 5.4e-4 SMART
IGc1 269 342 8.51e-7 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.5%
Validation Efficiency 97% (107/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the signal-regulatory-protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. This protein can be phosphorylated by tyrosine kinases. The phospho-tyrosine residues of this PTP have been shown to recruit SH2 domain containing tyrosine phosphatases (PTP), and serve as substrates of PTPs. This protein was found to participate in signal transduction mediated by various growth factor receptors. CD47 has been demonstrated to be a ligand for this receptor protein. This gene and its product share very high similarity with several other members of the SIRP family. These related genes are located in close proximity to each other on chromosome 20p13. Multiple alternatively spliced transcript variants have been determined for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display mild thrombocytopenia, fatty livers, decreased body weight, decreased proportion of single positive T cells, enhanced peritoneal macrophage phagocytosis and impaired Langerhans cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,432 S1937P probably damaging Het
Adgb G T 10: 10,382,721 probably benign Het
Aldh1a7 T C 19: 20,716,019 K179E probably damaging Het
Angptl7 G A 4: 148,497,426 R168C probably damaging Het
Atp8b1 T A 18: 64,573,492 I208F possibly damaging Het
Bco1 A G 8: 117,130,608 Y438C probably benign Het
Btrc A C 19: 45,512,661 K218Q probably damaging Het
Cct8l1 G A 5: 25,517,699 V471M probably damaging Het
Cd180 C T 13: 102,706,242 L599F probably benign Het
Cd300e T C 11: 115,054,518 N150S probably benign Het
Clcn1 C A 6: 42,294,145 T281K probably damaging Het
Cnnm3 T C 1: 36,518,957 S417P probably damaging Het
Cspg4 T A 9: 56,897,492 S1862R probably benign Het
Cspg5 A T 9: 110,262,138 N432Y probably damaging Het
Cyp2r1 T A 7: 114,553,216 I169F probably damaging Het
D130043K22Rik T A 13: 24,875,999 S618T probably damaging Het
Diaph3 G A 14: 86,965,549 P635L probably damaging Het
Dlg1 A G 16: 31,665,667 I38V possibly damaging Het
Dlk1 T G 12: 109,459,759 V186G probably damaging Het
Dmxl2 T C 9: 54,423,224 probably benign Het
Dnajc17 G A 2: 119,183,683 R132* probably null Het
Dock9 G T 14: 121,609,798 N1042K probably benign Het
Dok7 A T 5: 35,086,650 Q511L probably damaging Het
Espnl G A 1: 91,344,603 E562K possibly damaging Het
Evi5 G A 5: 107,795,841 T562I probably benign Het
Exd2 T A 12: 80,489,479 D294E probably benign Het
Fbn1 A T 2: 125,403,228 D246E possibly damaging Het
Fbxw16 A T 9: 109,439,582 W247R possibly damaging Het
Fcer1a A G 1: 173,225,437 I64T probably benign Het
Fcgbp C A 7: 28,105,175 Q1903K possibly damaging Het
Fmn1 A G 2: 113,365,355 S467G unknown Het
Fndc7 T A 3: 108,870,534 T369S probably damaging Het
Fnta T C 8: 26,000,966 probably benign Het
Gak A T 5: 108,606,892 H289Q probably damaging Het
Gas2l3 A G 10: 89,417,014 probably benign Het
Gbp8 T C 5: 105,016,121 N437S probably benign Het
Gk5 G A 9: 96,150,797 probably null Het
Gm21818 T A 13: 120,173,189 D2E probably benign Het
Hid1 A T 11: 115,348,473 V788E probably damaging Het
Hmcn1 T C 1: 150,563,568 T5505A probably damaging Het
Igf1r T A 7: 68,195,074 M865K probably benign Het
Katnal2 G A 18: 77,002,537 T258I probably damaging Het
Kdm3b A T 18: 34,803,504 I280L probably benign Het
Kif24 A G 4: 41,409,787 V382A probably damaging Het
Kif2a A T 13: 106,978,132 probably benign Het
Klhl10 A G 11: 100,442,196 I56V probably benign Het
Klk6 C T 7: 43,829,271 Q201* probably null Het
Klra3 A T 6: 130,323,708 S233T probably benign Het
Krt9 A T 11: 100,191,305 M223K probably damaging Het
Lama4 G A 10: 39,060,224 E632K probably benign Het
Lamb1 T C 12: 31,278,525 Y163H probably damaging Het
Lipo1 A G 19: 33,787,421 I11T probably benign Het
Lix1l T A 3: 96,623,891 H333Q possibly damaging Het
Mal2 T A 15: 54,588,387 M68K probably damaging Het
Map2k2 T C 10: 81,121,100 I104T probably damaging Het
Matn2 T C 15: 34,428,785 V765A probably damaging Het
Mptx2 T A 1: 173,274,473 K216N probably damaging Het
Mup5 C T 4: 61,832,341 probably null Het
Mycbp2 A G 14: 103,182,419 Y2494H probably damaging Het
Myh3 G A 11: 67,099,394 D1622N probably benign Het
Myo6 T C 9: 80,270,049 I609T possibly damaging Het
Ndst1 G A 18: 60,702,837 T458I probably damaging Het
Neb A T 2: 52,235,677 Y3622N probably damaging Het
Ntm A G 9: 29,179,100 Y108H probably benign Het
Olfr273 T G 4: 52,855,730 K261T probably benign Het
Olfr43 T C 11: 74,206,572 I215V probably benign Het
Olfr596 T C 7: 103,310,242 Y174H possibly damaging Het
Pappa2 T A 1: 158,814,368 I1373F possibly damaging Het
Pear1 A G 3: 87,754,492 probably benign Het
Phc3 C T 3: 30,961,820 A81T probably damaging Het
Pmepa1 A G 2: 173,234,360 S105P probably damaging Het
Ppp6r1 T C 7: 4,642,031 I248V probably benign Het
Prdm4 G A 10: 85,893,392 T717I probably damaging Het
Prom1 T C 5: 44,011,224 T669A probably benign Het
Ptpn5 T A 7: 47,090,768 I96F probably benign Het
Ptpro T C 6: 137,430,743 L922P probably damaging Het
Reck A T 4: 43,890,982 H40L probably benign Het
Rreb1 T A 13: 37,930,923 C753S probably benign Het
Sacs T C 14: 61,210,897 L3464P probably damaging Het
Samsn1 A T 16: 75,870,775 D304E probably benign Het
Scgb2b3 T C 7: 31,360,196 N51S possibly damaging Het
Shroom3 T C 5: 92,940,656 S341P probably damaging Het
Siglece T C 7: 43,659,293 D212G probably damaging Het
Spata21 T C 4: 141,111,296 S553P possibly damaging Het
Speer4b T A 5: 27,500,238 probably benign Het
Srgap2 T C 1: 131,319,638 D552G probably damaging Het
Stab2 A G 10: 86,954,234 I556T probably benign Het
Strip1 C T 3: 107,626,731 probably null Het
Stxbp6 T A 12: 44,902,870 D92V probably damaging Het
Styx A G 14: 45,356,758 K46E probably damaging Het
Supt20 T A 3: 54,710,420 V314E probably damaging Het
Syne2 T A 12: 75,938,729 D1650E probably benign Het
Szt2 T A 4: 118,405,517 K21M probably damaging Het
Tbx4 A T 11: 85,911,207 H222L probably damaging Het
Tmx3 A T 18: 90,532,997 I254L probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpv2 A T 11: 62,594,226 probably benign Het
Ubap2 A G 4: 41,202,380 S683P probably benign Het
Ube2d3 C T 3: 135,465,211 R139W probably benign Het
Ubox5 G T 2: 130,591,874 Q518K probably benign Het
Usp42 T C 5: 143,717,102 N588S probably damaging Het
Vars2 G A 17: 35,660,084 T618M probably damaging Het
Wfdc17 A T 11: 83,704,904 N65Y probably damaging Het
Zbtb38 G A 9: 96,688,041 P330L probably damaging Het
Zfp385a C T 15: 103,315,881 probably null Het
Zfp637 T A 6: 117,845,412 L167H probably damaging Het
Other mutations in Sirpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Sirpa APN 2 129609183 missense probably damaging 1.00
IGL01138:Sirpa APN 2 129630165 missense probably damaging 1.00
IGL01835:Sirpa APN 2 129615564 missense possibly damaging 0.76
IGL02558:Sirpa APN 2 129630069 missense probably damaging 1.00
IGL02825:Sirpa APN 2 129615452 missense probably damaging 0.99
IGL03083:Sirpa APN 2 129629928 missense probably damaging 1.00
R0234:Sirpa UTSW 2 129615468 missense probably damaging 0.99
R0234:Sirpa UTSW 2 129615468 missense probably damaging 0.99
R0831:Sirpa UTSW 2 129627936 splice site probably benign
R1550:Sirpa UTSW 2 129630041 missense probably damaging 1.00
R1806:Sirpa UTSW 2 129615512 missense probably damaging 1.00
R1927:Sirpa UTSW 2 129616376 missense possibly damaging 0.46
R2568:Sirpa UTSW 2 129615648 missense probably benign 0.02
R4849:Sirpa UTSW 2 129609243 missense probably damaging 1.00
R5182:Sirpa UTSW 2 129615732 missense possibly damaging 0.65
R5673:Sirpa UTSW 2 129630102 missense probably damaging 1.00
R5680:Sirpa UTSW 2 129616252 missense probably benign 0.02
R6521:Sirpa UTSW 2 129630155 missense probably damaging 1.00
R6821:Sirpa UTSW 2 129630097 missense probably damaging 1.00
Z1088:Sirpa UTSW 2 129618535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTCAATGAACCAGGTGAACCTC -3'
(R):5'- TCATCAGACCTATCCAGACAGGAGC -3'

Sequencing Primer
(F):5'- GTGAACCTCACCTGCCG -3'
(R):5'- ATGCTGGAGAAGCAGTTCCC -3'
Posted On2014-05-23