Incidental Mutation 'R0082:Synrg'
ID19728
Institutional Source Beutler Lab
Gene Symbol Synrg
Ensembl Gene ENSMUSG00000034940
Gene Namesynergin, gamma
SynonymsAp1gbp1, L71-5
MMRRC Submission 038369-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0082 (G1)
Quality Score167
Status Validated
Chromosome11
Chromosomal Location83964428-84044578 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 83987910 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049714] [ENSMUST00000092834] [ENSMUST00000183456] [ENSMUST00000183714]
Predicted Effect probably benign
Transcript: ENSMUST00000049714
SMART Domains Protein: ENSMUSP00000059000
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
coiled coil region 113 153 N/A INTRINSIC
Blast:EH 301 368 8e-6 BLAST
low complexity region 560 569 N/A INTRINSIC
low complexity region 644 662 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1295 1306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092834
SMART Domains Protein: ENSMUSP00000090510
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 222 289 5e-6 BLAST
low complexity region 481 490 N/A INTRINSIC
low complexity region 565 583 N/A INTRINSIC
internal_repeat_1 617 755 7.57e-6 PROSPERO
internal_repeat_1 746 879 7.57e-6 PROSPERO
low complexity region 880 894 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138676
SMART Domains Protein: ENSMUSP00000117709
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Blast:EH 134 201 3e-7 BLAST
SCOP:d1fi6a_ 147 208 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148901
Predicted Effect probably benign
Transcript: ENSMUST00000183456
SMART Domains Protein: ENSMUSP00000138969
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
Blast:EH 401 468 7e-6 BLAST
low complexity region 660 669 N/A INTRINSIC
low complexity region 744 762 N/A INTRINSIC
internal_repeat_1 796 934 2.26e-5 PROSPERO
internal_repeat_1 925 1058 2.26e-5 PROSPERO
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183714
SMART Domains Protein: ENSMUSP00000139103
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 300 367 6e-6 BLAST
low complexity region 559 568 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
internal_repeat_1 695 833 1.34e-5 PROSPERO
internal_repeat_1 824 957 1.34e-5 PROSPERO
low complexity region 958 972 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.3%
  • 10x: 91.7%
  • 20x: 73.7%
Validation Efficiency 94% (136/144)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the gamma subunit of AP1 clathrin-adaptor complex. The AP1 complex is located at the trans-Golgi network and associates specific proteins with clathrin-coated vesicles. This encoded protein may act to connect the AP1 complex to other proteins. Alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ankrd33b T C 15: 31,297,789 N274S probably benign Het
Arhgef1 C T 7: 24,912,605 Q100* probably null Het
BC030499 T C 11: 78,293,558 S244P probably damaging Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Cdh4 A T 2: 179,894,188 N844I possibly damaging Het
Cep57 T C 9: 13,810,876 probably benign Het
Dnah7a A T 1: 53,518,708 D2182E probably damaging Het
Dync1h1 A G 12: 110,636,446 T2174A probably benign Het
Eef1akmt2 T A 7: 132,851,472 R44* probably null Het
Evpl T A 11: 116,235,003 I43F probably damaging Het
F13a1 G T 13: 36,988,953 P151Q probably damaging Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Galnt5 A T 2: 57,999,035 I216F possibly damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gpr139 T A 7: 119,145,045 T106S probably benign Het
Hoxb3 A G 11: 96,344,271 D8G probably damaging Het
Hpse T C 5: 100,692,262 K330E possibly damaging Het
Kcmf1 G T 6: 72,850,487 probably null Het
Klra2 T C 6: 131,220,247 N263S possibly damaging Het
Klra8 T C 6: 130,125,055 D139G probably benign Het
Lrrc46 A C 11: 97,041,077 probably benign Het
Ly86 A T 13: 37,418,537 probably null Het
Mmp20 C T 9: 7,642,807 T214M probably benign Het
Olfr591 G T 7: 103,173,202 A145E probably benign Het
Olfr729 A T 14: 50,148,055 I273K probably damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pigg A G 5: 108,312,885 probably benign Het
Polq C A 16: 37,017,257 T177K probably benign Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ppip5k2 A T 1: 97,759,332 C49* probably null Het
Prkrip1 T C 5: 136,197,828 N53D possibly damaging Het
Prrc2b T C 2: 32,212,298 probably benign Het
Qprt T C 7: 127,108,186 E246G probably damaging Het
Rpl9 A G 5: 65,388,652 V167A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgsm1 T C 5: 113,288,836 I43V probably benign Het
Slc38a7 A G 8: 95,840,481 probably benign Het
Slc8b1 A G 5: 120,524,200 probably benign Het
Sp2 T C 11: 96,961,699 Y133C probably damaging Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Stox2 A T 8: 47,203,282 probably benign Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tmem97 G T 11: 78,542,588 F160L probably damaging Het
Utp6 A T 11: 79,953,631 H189Q possibly damaging Het
Vip T A 10: 5,644,953 *172R probably null Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Wipi1 T C 11: 109,578,284 probably benign Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in Synrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Synrg APN 11 84039246 missense probably damaging 0.98
IGL01640:Synrg APN 11 83981508 missense probably damaging 1.00
IGL01936:Synrg APN 11 84019705 missense probably benign 0.00
IGL02311:Synrg APN 11 84019804 missense probably benign 0.01
IGL02836:Synrg APN 11 84001978 splice site probably benign
IGL02868:Synrg APN 11 83987050 splice site probably benign
IGL03185:Synrg APN 11 83981479 missense probably damaging 1.00
IGL03224:Synrg APN 11 84039666 missense possibly damaging 0.86
polaris UTSW 11 84019914 missense probably damaging 1.00
P0041:Synrg UTSW 11 83982311 splice site probably benign
R0023:Synrg UTSW 11 84008653 missense probably damaging 1.00
R0044:Synrg UTSW 11 84009181 missense probably damaging 1.00
R0227:Synrg UTSW 11 84009432 missense probably damaging 1.00
R0361:Synrg UTSW 11 84024337 splice site probably null
R0494:Synrg UTSW 11 84019543 missense probably benign
R0548:Synrg UTSW 11 83982188 splice site probably benign
R0744:Synrg UTSW 11 84024305 nonsense probably null
R1114:Synrg UTSW 11 84023436 splice site probably benign
R1240:Synrg UTSW 11 84023356 missense probably damaging 1.00
R1989:Synrg UTSW 11 84019955 critical splice donor site probably null
R2247:Synrg UTSW 11 84009376 missense probably damaging 1.00
R2263:Synrg UTSW 11 83977152 missense possibly damaging 0.79
R2420:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2421:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2937:Synrg UTSW 11 83994354 missense probably damaging 1.00
R3783:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3784:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3785:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3787:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3925:Synrg UTSW 11 84040899 missense probably benign 0.03
R3945:Synrg UTSW 11 84023406 missense probably damaging 1.00
R3950:Synrg UTSW 11 83989815 missense probably damaging 1.00
R5165:Synrg UTSW 11 83990935 missense probably benign 0.02
R5216:Synrg UTSW 11 83982196 missense probably damaging 0.99
R5293:Synrg UTSW 11 83981499 missense probably damaging 1.00
R5561:Synrg UTSW 11 84002240 splice site probably null
R5575:Synrg UTSW 11 84009552 critical splice donor site probably null
R6079:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6085:Synrg UTSW 11 84039661 missense possibly damaging 0.80
R6138:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6259:Synrg UTSW 11 84008658 missense probably damaging 1.00
R6751:Synrg UTSW 11 83981425 missense probably damaging 1.00
R6795:Synrg UTSW 11 84019914 missense probably damaging 1.00
R6944:Synrg UTSW 11 84025086 missense probably damaging 1.00
R7092:Synrg UTSW 11 84008857 missense possibly damaging 0.95
R7109:Synrg UTSW 11 84039672 missense possibly damaging 0.82
R7291:Synrg UTSW 11 84009381 missense probably damaging 1.00
R7489:Synrg UTSW 11 83990825 missense probably benign 0.33
U15987:Synrg UTSW 11 84024300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACATTAGACATTGCGAGCCTCC -3'
(R):5'- GTCACTCCCAATAAAGCAGTCTTTCCC -3'

Sequencing Primer
(F):5'- TTGCGAGCCTCCTGCAAC -3'
(R):5'- actgcctccgtctgctg -3'
Posted On2013-04-11