Incidental Mutation 'R3783:Synrg'
ID272131
Institutional Source Beutler Lab
Gene Symbol Synrg
Ensembl Gene ENSMUSG00000034940
Gene Namesynergin, gamma
SynonymsAp1gbp1, L71-5
MMRRC Submission 040875-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3783 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83964428-84044578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84001920 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 613 (F613S)
Ref Sequence ENSEMBL: ENSMUSP00000138969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049714] [ENSMUST00000092834] [ENSMUST00000183456] [ENSMUST00000183714]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049714
AA Change: F513S

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059000
Gene: ENSMUSG00000034940
AA Change: F513S

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
coiled coil region 113 153 N/A INTRINSIC
Blast:EH 301 368 8e-6 BLAST
low complexity region 560 569 N/A INTRINSIC
low complexity region 644 662 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1295 1306 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092834
AA Change: F434S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090510
Gene: ENSMUSG00000034940
AA Change: F434S

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 222 289 5e-6 BLAST
low complexity region 481 490 N/A INTRINSIC
low complexity region 565 583 N/A INTRINSIC
internal_repeat_1 617 755 7.57e-6 PROSPERO
internal_repeat_1 746 879 7.57e-6 PROSPERO
low complexity region 880 894 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183456
AA Change: F613S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138969
Gene: ENSMUSG00000034940
AA Change: F613S

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
Blast:EH 401 468 7e-6 BLAST
low complexity region 660 669 N/A INTRINSIC
low complexity region 744 762 N/A INTRINSIC
internal_repeat_1 796 934 2.26e-5 PROSPERO
internal_repeat_1 925 1058 2.26e-5 PROSPERO
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183714
AA Change: F512S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139103
Gene: ENSMUSG00000034940
AA Change: F512S

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 300 367 6e-6 BLAST
low complexity region 559 568 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
internal_repeat_1 695 833 1.34e-5 PROSPERO
internal_repeat_1 824 957 1.34e-5 PROSPERO
low complexity region 958 972 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Meta Mutation Damage Score 0.422 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the gamma subunit of AP1 clathrin-adaptor complex. The AP1 complex is located at the trans-Golgi network and associates specific proteins with clathrin-coated vesicles. This encoded protein may act to connect the AP1 complex to other proteins. Alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Akap6 A G 12: 52,880,769 H154R probably damaging Het
Aoc1 T C 6: 48,905,655 L177P probably damaging Het
Ascc3 A G 10: 50,728,254 T1357A probably damaging Het
Atp13a3 A T 16: 30,354,249 V270D probably damaging Het
BC055324 A T 1: 163,987,683 C90S probably benign Het
Carmil3 T C 14: 55,496,976 F418S probably damaging Het
Ccdc93 A G 1: 121,437,869 N77S probably damaging Het
Cpt1b T C 15: 89,425,189 K47R probably damaging Het
Cyp4f14 A G 17: 32,916,762 Y42H probably benign Het
Dmxl1 G A 18: 49,865,122 S763N probably damaging Het
Fam129a C T 1: 151,689,648 S243L possibly damaging Het
Fancd2 T G 6: 113,565,204 S770A probably damaging Het
Flnb T G 14: 7,889,236 W529G probably benign Het
Fryl T C 5: 73,101,476 Y655C probably benign Het
Gml C T 15: 74,813,672 V155M probably damaging Het
Gpr174 A G X: 107,293,064 T161A probably benign Het
Heatr1 G T 13: 12,434,460 L1946F probably damaging Het
Inpp5k T C 11: 75,647,686 L461P probably damaging Het
Isy1 T C 6: 87,821,545 E209G possibly damaging Het
Kdm5b A G 1: 134,630,542 H1429R probably benign Het
Magi2 C T 5: 20,465,909 T580M probably damaging Het
Map3k1 C T 13: 111,756,220 V834I probably benign Het
Mdn1 A T 4: 32,720,818 E2310D probably benign Het
Myo15 A T 11: 60,477,572 Y386F probably damaging Het
Neurod1 T A 2: 79,454,595 N148I probably damaging Het
Nsa2 G T 13: 97,135,534 Q60K possibly damaging Het
Pcdha1 T A 18: 36,930,802 L173Q probably damaging Het
Pdpk1 T C 17: 24,110,850 T71A possibly damaging Het
Plxna2 T A 1: 194,807,521 V1692E probably damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Psg27 T A 7: 18,560,354 Q376L probably damaging Het
Psmd4 T C 3: 95,035,251 D6G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rala T A 13: 17,882,446 E185V probably benign Het
Sall4 A G 2: 168,756,123 S266P probably damaging Het
Scn10a T C 9: 119,691,562 T91A probably damaging Het
Tekt1 A G 11: 72,344,894 I376T probably damaging Het
Tet2 T C 3: 133,479,363 K1182R possibly damaging Het
Thbs4 T C 13: 92,773,164 N375S probably benign Het
Thoc5 A G 11: 4,920,372 probably benign Het
Tmprss9 G T 10: 80,887,467 V254F probably damaging Het
Tro G A X: 150,655,052 T203I possibly damaging Het
Ttbk2 A T 2: 120,773,815 probably benign Het
Usf2 A G 7: 30,955,831 V133A probably benign Het
Wap G A 11: 6,638,550 Q25* probably null Het
Xdh C T 17: 73,893,595 probably benign Het
Xrn1 G T 9: 95,969,285 M153I probably benign Het
Other mutations in Synrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Synrg APN 11 84039246 missense probably damaging 0.98
IGL01640:Synrg APN 11 83981508 missense probably damaging 1.00
IGL01936:Synrg APN 11 84019705 missense probably benign 0.00
IGL02311:Synrg APN 11 84019804 missense probably benign 0.01
IGL02836:Synrg APN 11 84001978 splice site probably benign
IGL02868:Synrg APN 11 83987050 splice site probably benign
IGL03185:Synrg APN 11 83981479 missense probably damaging 1.00
IGL03224:Synrg APN 11 84039666 missense possibly damaging 0.86
polaris UTSW 11 84019914 missense probably damaging 1.00
P0041:Synrg UTSW 11 83982311 splice site probably benign
R0023:Synrg UTSW 11 84008653 missense probably damaging 1.00
R0044:Synrg UTSW 11 84009181 missense probably damaging 1.00
R0082:Synrg UTSW 11 83987910 splice site probably benign
R0227:Synrg UTSW 11 84009432 missense probably damaging 1.00
R0361:Synrg UTSW 11 84024337 splice site probably null
R0494:Synrg UTSW 11 84019543 missense probably benign
R0548:Synrg UTSW 11 83982188 splice site probably benign
R0744:Synrg UTSW 11 84024305 nonsense probably null
R1114:Synrg UTSW 11 84023436 splice site probably benign
R1240:Synrg UTSW 11 84023356 missense probably damaging 1.00
R1989:Synrg UTSW 11 84019955 critical splice donor site probably null
R2247:Synrg UTSW 11 84009376 missense probably damaging 1.00
R2263:Synrg UTSW 11 83977152 missense possibly damaging 0.79
R2420:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2421:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2937:Synrg UTSW 11 83994354 missense probably damaging 1.00
R3784:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3785:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3787:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3925:Synrg UTSW 11 84040899 missense probably benign 0.03
R3945:Synrg UTSW 11 84023406 missense probably damaging 1.00
R3950:Synrg UTSW 11 83989815 missense probably damaging 1.00
R5165:Synrg UTSW 11 83990935 missense probably benign 0.02
R5216:Synrg UTSW 11 83982196 missense probably damaging 0.99
R5293:Synrg UTSW 11 83981499 missense probably damaging 1.00
R5561:Synrg UTSW 11 84002240 splice site probably null
R5575:Synrg UTSW 11 84009552 critical splice donor site probably null
R6079:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6085:Synrg UTSW 11 84039661 missense possibly damaging 0.80
R6138:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6259:Synrg UTSW 11 84008658 missense probably damaging 1.00
R6751:Synrg UTSW 11 83981425 missense probably damaging 1.00
R6795:Synrg UTSW 11 84019914 missense probably damaging 1.00
R6944:Synrg UTSW 11 84025086 missense probably damaging 1.00
R7092:Synrg UTSW 11 84008857 missense possibly damaging 0.95
R7109:Synrg UTSW 11 84039672 missense possibly damaging 0.82
R7291:Synrg UTSW 11 84009381 missense probably damaging 1.00
R7489:Synrg UTSW 11 83990825 missense probably benign 0.33
U15987:Synrg UTSW 11 84024300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATTCCCAGGCAGTCTGTC -3'
(R):5'- TACATTGGGCAGCGCAAAC -3'

Sequencing Primer
(F):5'- GTACTCACTATGTAGACCAGACTGG -3'
(R):5'- TGGGCAGCGCAAACATATTTAAC -3'
Posted On2015-03-25