Incidental Mutation 'R0083:Sppl2c'
ID19769
Institutional Source Beutler Lab
Gene Symbol Sppl2c
Ensembl Gene ENSMUSG00000049506
Gene Namesignal peptide peptidase 2C
Synonyms
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R0083 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104186327-104191163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104186532 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 53 (V53I)
Ref Sequence ENSEMBL: ENSMUSP00000102613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059448] [ENSMUST00000107000]
Predicted Effect probably benign
Transcript: ENSMUST00000059448
AA Change: V53I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091453
Gene: ENSMUSG00000049506
AA Change: V53I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PA 62 169 1.8e-8 PFAM
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
PSN 256 528 1.08e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107000
AA Change: V53I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102613
Gene: ENSMUSG00000049506
AA Change: V53I

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PA 62 169 2.3e-8 PFAM
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
PSN 256 528 1.08e-95 SMART
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Sppl2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Sppl2c APN 11 104186979 missense possibly damaging 0.83
IGL02326:Sppl2c APN 11 104187273 missense probably benign 0.27
IGL02479:Sppl2c APN 11 104186937 missense probably benign
H8786:Sppl2c UTSW 11 104186865 missense probably benign 0.04
R1625:Sppl2c UTSW 11 104187169 missense probably damaging 0.98
R1913:Sppl2c UTSW 11 104187889 missense probably benign 0.15
R2037:Sppl2c UTSW 11 104186481 missense probably benign 0.23
R2869:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2869:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2871:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2871:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2873:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3009:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3010:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3011:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R4698:Sppl2c UTSW 11 104188315 missense probably benign 0.21
R4718:Sppl2c UTSW 11 104188315 missense probably benign 0.21
R4841:Sppl2c UTSW 11 104187652 missense probably benign 0.06
R4842:Sppl2c UTSW 11 104187652 missense probably benign 0.06
R5248:Sppl2c UTSW 11 104186581 missense possibly damaging 0.88
R5288:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5300:Sppl2c UTSW 11 104187075 missense possibly damaging 0.52
R5384:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5386:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5427:Sppl2c UTSW 11 104187867 missense probably benign 0.01
R5452:Sppl2c UTSW 11 104187300 missense probably benign
R5796:Sppl2c UTSW 11 104187793 missense probably benign 0.00
R6112:Sppl2c UTSW 11 104187137 missense probably benign 0.00
R6452:Sppl2c UTSW 11 104188191 missense probably benign 0.01
R6476:Sppl2c UTSW 11 104186769 missense probably benign
R7368:Sppl2c UTSW 11 104187604 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGTGACCAAGAGCCACACCC -3'
(R):5'- GCATAGAAGCTACAGTTGCCACGC -3'

Sequencing Primer
(F):5'- TTCCCCTGGGAGGGTAATAGAG -3'
(R):5'- CCTGGTGGAAAGAGTCTTCATCTG -3'
Posted On2013-04-11