Incidental Mutation 'R1807:Drd2'
ID203540
Institutional Source Beutler Lab
Gene Symbol Drd2
Ensembl Gene ENSMUSG00000032259
Gene Namedopamine receptor D2
SynonymsDrd-2, D2 receptor, D2R
MMRRC Submission 039836-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R1807 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location49340627-49408177 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 49405067 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 376 (L376F)
Ref Sequence ENSEMBL: ENSMUSP00000075170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075764]
Predicted Effect probably damaging
Transcript: ENSMUST00000075764
AA Change: L376F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075170
Gene: ENSMUSG00000032259
AA Change: L376F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 45 238 2.5e-15 PFAM
Pfam:7tm_1 51 427 1.2e-88 PFAM
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.7%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D2 subtype of the dopamine receptor. This G-protein coupled receptor inhibits adenylyl cyclase activity. A missense mutation in this gene causes myoclonus dystonia; other mutations have been associated with schizophrenia. Alternative splicing of this gene results in two transcript variants encoding different isoforms. A third variant has been described, but it has not been determined whether this form is normal or due to aberrant splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show Parkinson's disease like symptoms, including akinetic and bradykinetic behavior. Mice lacking only the long isoform are hypoactive and exhibit increased sterotypic behavior in response to dopamine agonists. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C T 17: 35,895,069 W27* probably null Het
4933425L06Rik A T 13: 105,082,236 Q26L probably benign Het
4933430I17Rik T A 4: 62,542,756 Y289* probably null Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
A3galt2 A G 4: 128,767,601 I348V probably benign Het
Abca13 A G 11: 9,291,755 Y1206C probably damaging Het
Adar T C 3: 89,734,865 S18P probably benign Het
Akr1cl T C 1: 65,021,947 D139G possibly damaging Het
Aldh1b1 A G 4: 45,802,873 Y137C possibly damaging Het
Arsa T C 15: 89,475,322 M86V possibly damaging Het
Atg9b C A 5: 24,387,057 R648L probably damaging Het
Atrn A G 2: 130,982,772 N1042S possibly damaging Het
Ccdc130 C T 8: 84,260,307 R187Q probably damaging Het
Ccdc6 T A 10: 70,175,159 D325E possibly damaging Het
Cdk12 T C 11: 98,210,377 S354P unknown Het
Chst3 T A 10: 60,186,308 Y239F probably benign Het
Cilp2 C A 8: 69,882,194 R718L probably damaging Het
Col27a1 A G 4: 63,331,349 probably benign Het
Ctbp2 T C 7: 133,014,408 N266S probably benign Het
Ctnnd2 T C 15: 30,619,871 V123A probably damaging Het
D7Ertd443e T A 7: 134,293,305 E552V probably null Het
Dcst1 T A 3: 89,353,541 H516L probably damaging Het
Edn1 A G 13: 42,306,794 N175S probably damaging Het
Eipr1 G T 12: 28,766,839 G65V probably damaging Het
Epha4 G A 1: 77,374,904 P905S probably benign Het
Erbb2 T C 11: 98,428,854 Y591H probably damaging Het
Fam135b G A 15: 71,463,912 R478C probably benign Het
Fam49a G A 12: 12,361,504 R123Q probably benign Het
Fat2 T C 11: 55,289,259 T1419A probably damaging Het
Flnb C T 14: 7,934,645 T2239I probably benign Het
Gm7713 T C 15: 59,994,471 noncoding transcript Het
Gm9008 A G 6: 76,497,414 V73A probably benign Het
Hsf5 C T 11: 87,657,342 P617L probably benign Het
Kcnk12 C A 17: 87,746,040 R398L probably benign Het
Kif21b T A 1: 136,147,793 N219K possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra5 A T 6: 129,899,420 F141L probably benign Het
Lmtk3 C T 7: 45,793,278 P462S probably benign Het
Mast2 A G 4: 116,310,741 probably benign Het
Me1 T A 9: 86,650,879 T197S probably damaging Het
Msr1 T A 8: 39,619,907 Q267L probably benign Het
Nfic T C 10: 81,404,985 T328A probably benign Het
Nphp3 G A 9: 104,020,741 D390N probably benign Het
Nr2e1 T A 10: 42,582,909 probably null Het
Olfr1094 T A 2: 86,829,101 F116L probably benign Het
Olfr603 T A 7: 103,383,583 N140Y probably benign Het
Pard6b T C 2: 168,087,412 L46P probably damaging Het
Prkaa1 T A 15: 5,143,954 L20Q probably damaging Het
Rapgefl1 T C 11: 98,845,989 probably null Het
Recql5 T C 11: 115,895,115 K611E possibly damaging Het
Rexo1 A T 10: 80,542,579 I1180N possibly damaging Het
Rph3a T C 5: 120,945,393 N605D probably damaging Het
Sema6a A G 18: 47,276,424 V592A possibly damaging Het
Skint11 A T 4: 114,194,696 R80S probably benign Het
Smpdl3a C A 10: 57,801,022 P72H probably damaging Het
Sobp T G 10: 43,160,826 M39L possibly damaging Het
Sparcl1 T A 5: 104,085,761 Y574F probably damaging Het
Spns3 C T 11: 72,538,340 W206* probably null Het
Srf A G 17: 46,553,759 V190A possibly damaging Het
Stag1 T G 9: 100,908,666 H742Q probably benign Het
Strn3 A T 12: 51,627,203 S542T probably benign Het
Synpo2 T C 3: 123,080,257 E1020G possibly damaging Het
Tcerg1l T A 7: 138,395,097 H137L probably benign Het
Tlr12 A T 4: 128,617,436 D340E probably benign Het
Tmem130 T A 5: 144,755,364 T77S probably benign Het
Tmem143 C A 7: 45,897,613 R68S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Trem1 G T 17: 48,241,635 G67* probably null Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Txndc9 A T 1: 37,994,015 H95Q probably damaging Het
Zfp35 T A 18: 24,003,929 N443K probably benign Het
Other mutations in Drd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Drd2 APN 9 49395758 missense probably damaging 1.00
IGL01407:Drd2 APN 9 49400815 missense probably damaging 1.00
IGL01669:Drd2 APN 9 49402089 missense possibly damaging 0.90
IGL02011:Drd2 APN 9 49406958 missense probably damaging 1.00
IGL02417:Drd2 APN 9 49402259 splice site probably benign
R0374:Drd2 UTSW 9 49399784 missense probably benign 0.41
R0402:Drd2 UTSW 9 49404971 missense probably benign 0.00
R0529:Drd2 UTSW 9 49407074 missense probably benign
R1124:Drd2 UTSW 9 49395640 missense probably damaging 0.98
R1458:Drd2 UTSW 9 49402212 missense probably damaging 1.00
R1888:Drd2 UTSW 9 49402142 missense probably benign 0.05
R1888:Drd2 UTSW 9 49402142 missense probably benign 0.05
R1971:Drd2 UTSW 9 49407059 missense probably damaging 1.00
R2192:Drd2 UTSW 9 49403271 missense probably benign 0.03
R2218:Drd2 UTSW 9 49399794 missense probably damaging 1.00
R3830:Drd2 UTSW 9 49402143 missense probably damaging 0.99
R4214:Drd2 UTSW 9 49404921 missense probably benign 0.00
R4595:Drd2 UTSW 9 49404789 missense probably benign 0.03
R5392:Drd2 UTSW 9 49395628 missense possibly damaging 0.80
R5415:Drd2 UTSW 9 49402253 missense possibly damaging 0.81
R5598:Drd2 UTSW 9 49407015 missense possibly damaging 0.94
R5646:Drd2 UTSW 9 49404912 missense probably benign
R5715:Drd2 UTSW 9 49404889 missense probably benign 0.00
R5901:Drd2 UTSW 9 49406959 nonsense probably null
R6365:Drd2 UTSW 9 49406949 missense probably damaging 1.00
R6748:Drd2 UTSW 9 49403202 nonsense probably null
X0022:Drd2 UTSW 9 49400781 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTCTACATAGCAACCCTGAC -3'
(R):5'- TTTGCCCTTCTGTACAGCAG -3'

Sequencing Primer
(F):5'- TAGCAACCCTGACAGTCCTG -3'
(R):5'- GACACAACAGGAGATTCTACTAAATG -3'
Posted On2014-06-23