Incidental Mutation 'R1809:Cdk14'
ID203672
Institutional Source Beutler Lab
Gene Symbol Cdk14
Ensembl Gene ENSMUSG00000028926
Gene Namecyclin-dependent kinase 14
SynonymsPftk1
MMRRC Submission 039838-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1809 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location4803391-5420312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5010901 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 307 (M307L)
Ref Sequence ENSEMBL: ENSMUSP00000111112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030763] [ENSMUST00000115450] [ENSMUST00000115451] [ENSMUST00000115452]
Predicted Effect probably benign
Transcript: ENSMUST00000030763
AA Change: M325L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030763
Gene: ENSMUSG00000028926
AA Change: M325L

DomainStartEndE-ValueType
low complexity region 119 127 N/A INTRINSIC
S_TKc 135 419 3.63e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115450
AA Change: M279L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111110
Gene: ENSMUSG00000028926
AA Change: M279L

DomainStartEndE-ValueType
low complexity region 73 81 N/A INTRINSIC
S_TKc 89 373 3.63e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115451
AA Change: M279L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111111
Gene: ENSMUSG00000028926
AA Change: M279L

DomainStartEndE-ValueType
low complexity region 73 81 N/A INTRINSIC
S_TKc 89 373 3.63e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115452
AA Change: M307L

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111112
Gene: ENSMUSG00000028926
AA Change: M307L

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
S_TKc 117 401 3.63e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156660
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (107/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PFTK1 is a member of the CDC2 (MIM 116940)-related protein kinase family (Yang and Chen, 2001 [PubMed 11313143]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930502E18Rik A G X: 53,733,749 E99G probably benign Het
9130409I23Rik T C 1: 181,059,687 I279T probably damaging Het
Ablim2 A G 5: 35,843,270 probably benign Het
Adamts20 C T 15: 94,341,087 S750N probably damaging Het
Adh6a G A 3: 138,330,961 R370H possibly damaging Het
Akr1b7 A G 6: 34,419,111 N183D probably damaging Het
Aktip A T 8: 91,129,720 I43N probably damaging Het
Ankrd26 A T 6: 118,525,922 probably benign Het
Ano9 G A 7: 141,108,804 T144I possibly damaging Het
Anpep G T 7: 79,841,823 D143E probably benign Het
Aox2 C A 1: 58,294,325 Q234K probably benign Het
Ap1g1 C G 8: 109,833,182 probably benign Het
Arhgef4 G A 1: 34,810,555 probably null Het
Armc4 T A 18: 7,211,630 Y748F probably benign Het
Arsj A G 3: 126,438,295 Y230C possibly damaging Het
Asmt C T X: 170,675,745 probably benign Het
Astl A T 2: 127,345,485 K72N probably damaging Het
Atp2b2 G A 6: 113,803,743 probably benign Het
Baiap2l1 A C 5: 144,324,555 probably null Het
C7 A T 15: 5,034,339 N193K probably damaging Het
Cacna2d4 G T 6: 119,270,824 R362L probably damaging Het
Cct4 T A 11: 22,997,615 D189E probably benign Het
Cd300lg G A 11: 102,043,112 G62S probably benign Het
Cfi G A 3: 129,873,119 probably null Het
Clec2g G T 6: 128,980,310 probably null Het
Cntnap2 T C 6: 46,988,675 S807P probably damaging Het
Col6a3 T A 1: 90,827,949 H206L probably damaging Het
Cyp2c23 A T 19: 44,021,558 probably benign Het
Dlec1 T C 9: 119,136,699 V1058A probably benign Het
Dpp9 A G 17: 56,199,038 Y454H probably damaging Het
Drosha G A 15: 12,890,112 G920R probably null Het
Duox2 A G 2: 122,283,897 S1142P possibly damaging Het
Fam13a C T 6: 58,965,060 probably null Het
Filip1l A G 16: 57,506,660 R18G probably benign Het
Foxa1 A G 12: 57,542,741 V231A probably damaging Het
Gm11756 A G 4: 73,917,517 F237L probably benign Het
Gm4787 A T 12: 81,378,529 M285K possibly damaging Het
Gm5084 T A 13: 60,212,506 noncoding transcript Het
Gm6788 G A 19: 28,763,186 noncoding transcript Het
Gm9922 G T 14: 101,729,405 probably benign Het
Gtf3c4 A T 2: 28,833,976 Y440* probably null Het
Helq A G 5: 100,773,954 S795P probably damaging Het
Helz T A 11: 107,599,171 S151T possibly damaging Het
Irgm1 T C 11: 48,866,613 T124A probably benign Het
Itgam C T 7: 128,070,937 P134S possibly damaging Het
Kdm6a T C X: 18,236,684 Y217H probably benign Het
Kif6 T C 17: 49,901,784 L744P probably benign Het
Kmt2c C T 5: 25,284,192 R1203H probably damaging Het
Ksr2 A G 5: 117,555,470 T328A probably damaging Het
Lig1 T C 7: 13,300,355 probably benign Het
Lpar3 G A 3: 146,240,548 probably benign Het
Lrrk2 T C 15: 91,699,892 F285S possibly damaging Het
March7 A G 2: 60,232,293 D148G probably benign Het
Mcee T C 7: 64,400,301 L60S probably damaging Het
Mob2 A G 7: 142,016,374 I81T probably damaging Het
Mphosph8 T A 14: 56,672,452 D87E probably damaging Het
Myo1g T C 11: 6,512,283 T560A probably benign Het
Nagk C T 6: 83,797,187 T42I probably benign Het
Naip1 G T 13: 100,426,239 T806K probably benign Het
Ncor2 A G 5: 125,118,793 probably benign Het
Ocln G T 13: 100,511,459 Y401* probably null Het
Olfr922 G A 9: 38,816,147 V215I probably benign Het
Oma1 T A 4: 103,325,177 N292K probably damaging Het
Ovch2 T A 7: 107,790,205 probably null Het
Pcdhb16 T C 18: 37,478,388 F134L probably damaging Het
Pipox A T 11: 77,881,534 Y337N probably benign Het
Polr3b A G 10: 84,693,001 D763G probably damaging Het
Pygo1 T A 9: 72,944,796 N88K probably damaging Het
Rab3gap1 T C 1: 127,934,514 M674T probably damaging Het
Rbm25 T C 12: 83,672,727 probably benign Het
Rbm26 C T 14: 105,117,106 probably benign Het
Rbms2 G A 10: 128,138,186 T187I possibly damaging Het
Rnase11 T A 14: 51,049,727 R123S probably benign Het
Rngtt A G 4: 33,443,614 N485D probably benign Het
Rp1l1 A T 14: 64,027,966 M334L probably benign Het
Rps9 T A 7: 3,704,727 L56Q probably damaging Het
Saysd1 C A 14: 20,083,102 probably benign Het
Sema4d C T 13: 51,713,691 probably null Het
Shisa5 A T 9: 109,040,930 D34V probably damaging Het
Skil A G 3: 31,117,506 D547G probably damaging Het
Slc2a5 T A 4: 150,143,057 F444L probably damaging Het
Slc9b2 T G 3: 135,317,131 C10G possibly damaging Het
Sorcs2 G T 5: 36,229,220 probably benign Het
Stk17b T G 1: 53,765,981 K140N possibly damaging Het
Stradb T A 1: 58,994,390 L404Q possibly damaging Het
Synj2 T C 17: 6,026,551 M432T possibly damaging Het
Tanc1 G T 2: 59,800,097 R800L probably damaging Het
Tenm4 A G 7: 96,873,780 M1473V probably benign Het
Tesc A G 5: 118,061,602 I190V probably benign Het
Tex15 T C 8: 33,574,234 F1231L probably benign Het
Thrsp T C 7: 97,417,125 I127V probably benign Het
Tlr6 A T 5: 64,953,712 C617* probably null Het
Trank1 A T 9: 111,392,825 I2877F probably benign Het
Ucp1 T C 8: 83,297,867 S274P probably damaging Het
Ucp2 T A 7: 100,498,399 V195E probably damaging Het
Vars2 T C 17: 35,662,216 T394A probably damaging Het
Vmn1r1 A G 1: 182,157,806 V98A possibly damaging Het
Vmn1r225 A G 17: 20,502,656 I120V probably benign Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r25 A G 6: 123,825,378 V522A probably benign Het
Vmn2r70 T C 7: 85,565,922 I135V probably benign Het
Vwf T C 6: 125,590,175 probably benign Het
Zcchc11 T A 4: 108,549,355 H1373Q probably damaging Het
Zfp446 T C 7: 12,979,121 F29L probably damaging Het
Other mutations in Cdk14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Cdk14 APN 5 5249237 splice site probably benign
IGL01376:Cdk14 APN 5 5010839 missense probably damaging 1.00
IGL02102:Cdk14 APN 5 5380083 missense probably benign 0.01
IGL02179:Cdk14 APN 5 5103845 missense probably damaging 1.00
IGL02423:Cdk14 APN 5 4888905 missense probably benign 0.00
IGL03081:Cdk14 APN 5 4949527 splice site probably benign
IGL02988:Cdk14 UTSW 5 5036484 missense probably damaging 1.00
R0465:Cdk14 UTSW 5 5093019 missense probably damaging 1.00
R0630:Cdk14 UTSW 5 5135422 splice site probably benign
R1452:Cdk14 UTSW 5 4888927 missense possibly damaging 0.85
R1601:Cdk14 UTSW 5 5135378 missense probably damaging 1.00
R1629:Cdk14 UTSW 5 5103807 missense probably benign 0.18
R1659:Cdk14 UTSW 5 4949571 missense probably benign 0.08
R2013:Cdk14 UTSW 5 5093047 missense probably damaging 1.00
R2015:Cdk14 UTSW 5 5380082 missense probably benign
R2256:Cdk14 UTSW 5 4888924 missense probably benign
R2257:Cdk14 UTSW 5 4888924 missense probably benign
R2908:Cdk14 UTSW 5 5249051 missense probably benign 0.33
R4324:Cdk14 UTSW 5 5036532 nonsense probably null
R4432:Cdk14 UTSW 5 5036427 missense probably damaging 1.00
R4907:Cdk14 UTSW 5 5249140 missense probably damaging 0.96
R5426:Cdk14 UTSW 5 4888975 missense possibly damaging 0.93
R5708:Cdk14 UTSW 5 5266036 intron probably benign
R6006:Cdk14 UTSW 5 5249211 start codon destroyed probably null 0.33
R6120:Cdk14 UTSW 5 4894029 missense probably damaging 0.96
R7048:Cdk14 UTSW 5 5093005 missense probably damaging 1.00
R7104:Cdk14 UTSW 5 5195325 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GACACTAGTCAATGAATTCCCTGC -3'
(R):5'- CTGAGCTTGTTTAGGGTCCTCC -3'

Sequencing Primer
(F):5'- GTCAATGAATTCCCTGCTTCATAAAG -3'
(R):5'- GGTCCTCCCAGGTCAACAG -3'
Posted On2014-06-23