Incidental Mutation 'R1852:Kcng4'
ID208221
Institutional Source Beutler Lab
Gene Symbol Kcng4
Ensembl Gene ENSMUSG00000045246
Gene Namepotassium voltage-gated channel, subfamily G, member 4
SynonymsKV6.4, 4921535I01Rik, KV6.3
MMRRC Submission 039876-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.027) question?
Stock #R1852 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location119623854-119635680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119626208 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 321 (P321Q)
Ref Sequence ENSEMBL: ENSMUSP00000129687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061828] [ENSMUST00000164382]
Predicted Effect probably benign
Transcript: ENSMUST00000061828
AA Change: P321Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000056552
Gene: ENSMUSG00000045246
AA Change: P321Q

DomainStartEndE-ValueType
BTB 58 168 7.13e-3 SMART
Pfam:Ion_trans 218 462 1.2e-40 PFAM
Pfam:Ion_trans_2 370 457 7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164382
AA Change: P321Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129687
Gene: ENSMUSG00000045246
AA Change: P321Q

DomainStartEndE-ValueType
BTB 58 168 7.13e-3 SMART
Pfam:Ion_trans 262 451 6.6e-29 PFAM
Pfam:Ion_trans_2 371 457 1.7e-13 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member functions as a modulatory subunit. The gene has strong expression in brain. Multiple alternatively spliced variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,268,473 D499G probably damaging Het
2900092C05Rik A G 7: 12,512,702 probably null Het
4930433I11Rik T A 7: 40,993,613 D326E probably benign Het
A530032D15Rik G A 1: 85,085,131 probably benign Het
Abca8a T C 11: 110,069,386 D676G probably damaging Het
Abcb7 T C X: 104,305,399 M153V probably benign Het
Ablim3 G A 18: 61,849,395 H160Y probably benign Het
Acsl6 T C 11: 54,361,076 I683T probably damaging Het
Adgrg5 A T 8: 94,937,800 Y345F probably damaging Het
Alg6 T G 4: 99,746,362 F114V probably benign Het
Ank2 A C 3: 126,997,851 probably null Het
Ankrd24 A T 10: 81,642,941 probably benign Het
Ano8 T C 8: 71,483,487 K222E probably damaging Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Bmpr1b A T 3: 141,857,402 probably null Het
C3 A G 17: 57,222,823 V2A probably damaging Het
Capn1 A G 19: 6,009,103 V276A possibly damaging Het
Ccdc57 T C 11: 120,921,673 E85G probably damaging Het
Chil3 C T 3: 106,148,801 probably null Het
Chl1 A T 6: 103,699,159 probably null Het
Chodl C T 16: 78,941,258 P38L probably benign Het
Clec4a2 G T 6: 123,139,125 E124* probably null Het
Cmtr1 T C 17: 29,702,255 V825A probably benign Het
Cnksr3 T C 10: 7,120,539 I232V probably benign Het
Cntn1 C T 15: 92,305,140 R768C probably damaging Het
Col15a1 G T 4: 47,299,278 probably null Het
Col6a3 T A 1: 90,807,534 I798F possibly damaging Het
Cpxcr1 T A X: 116,478,061 L223* probably null Het
Cul1 A G 6: 47,520,830 N615S probably damaging Het
Cxcr2 A G 1: 74,159,279 I311V probably benign Het
Cyp2c67 C T 19: 39,617,367 G362S probably benign Het
D930048N14Rik T A 11: 51,653,865 probably benign Het
Ddx49 T C 8: 70,300,983 T79A probably damaging Het
Defb46 T A 8: 19,239,975 probably null Het
Dnah17 T A 11: 118,121,916 I145F probably damaging Het
Dock8 A T 19: 25,127,128 I725F probably benign Het
Dppa4 G A 16: 48,287,884 A11T probably damaging Het
Enam T A 5: 88,504,465 S1278T possibly damaging Het
Fndc3a A G 14: 72,556,843 V829A probably damaging Het
Gatb T G 3: 85,618,877 L354R probably damaging Het
Gm10787 A T 10: 77,021,877 noncoding transcript Het
Gm13084 T C 4: 143,812,826 I32M probably benign Het
Gsap T A 5: 21,290,545 probably null Het
Gtf2ird1 T C 5: 134,382,580 probably null Het
Has3 A T 8: 106,874,079 I58F probably damaging Het
Haus5 A T 7: 30,658,501 probably null Het
Hip1r T C 5: 123,991,505 V169A probably benign Het
Hnf1a T A 5: 114,970,711 D45V probably damaging Het
Il20ra T A 10: 19,743,019 Y72N probably damaging Het
Ipo11 A T 13: 106,812,257 V914E possibly damaging Het
Itpr1 T C 6: 108,386,706 L763P probably damaging Het
Katnal2 C A 18: 77,016,023 R104L probably benign Het
Larp4b T C 13: 9,137,303 probably null Het
Lars T C 18: 42,212,608 N1001S probably benign Het
Lhcgr T A 17: 88,765,176 I148F probably damaging Het
Lsm10 T A 4: 126,097,963 S37R possibly damaging Het
Mfsd13a A G 19: 46,372,180 probably null Het
Mipep T A 14: 60,843,240 C560* probably null Het
Mme A G 3: 63,327,983 S97G probably benign Het
Mme G A 3: 63,328,046 D172N probably benign Het
Mx1 A T 16: 97,448,203 L608Q probably damaging Het
Myt1l T C 12: 29,851,661 M208T probably benign Het
Neb T C 2: 52,228,542 I3987V probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Neto1 T C 18: 86,395,884 M1T probably null Het
Nom1 T C 5: 29,446,878 F738S possibly damaging Het
Olfr1137 T C 2: 87,710,973 probably null Het
Olfr1160 T G 2: 88,006,521 I86L probably damaging Het
Olfr1314 C A 2: 112,091,847 V285L probably benign Het
Olfr1420 C A 19: 11,896,885 P288H probably damaging Het
Olfr1487 C T 19: 13,619,603 S147F probably damaging Het
Olfr523 T A 7: 140,176,561 L147* probably null Het
Olfr572 C T 7: 102,928,441 S271L probably damaging Het
Olfr772 T C 10: 129,174,328 K231R probably benign Het
Pak1ip1 A G 13: 41,011,232 T264A possibly damaging Het
Palb2 G T 7: 122,114,314 D915E possibly damaging Het
Pank4 T C 4: 154,976,359 L491P probably damaging Het
Paqr7 T C 4: 134,507,669 V279A probably benign Het
Pcif1 G A 2: 164,888,466 R373Q probably damaging Het
Pdgfa T A 5: 138,979,172 N185I probably benign Het
Plcd4 T C 1: 74,549,361 V123A possibly damaging Het
Prune2 A G 19: 17,199,139 I154V probably damaging Het
Rac3 T G 11: 120,723,494 L148R possibly damaging Het
Rapgef6 T A 11: 54,642,811 D362E probably benign Het
Rbl1 A G 2: 157,174,903 I592T probably benign Het
Rbl2 A C 8: 91,095,563 D408A possibly damaging Het
Retreg2 A G 1: 75,146,675 K416E probably benign Het
Rorb A T 19: 18,962,083 L234H probably damaging Het
Rpp40 T G 13: 35,896,914 D279A probably benign Het
Siglec1 C A 2: 131,081,500 V442L probably damaging Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skiv2l2 A T 13: 112,872,927 H979Q probably benign Het
Slc25a34 G A 4: 141,622,268 T192I probably benign Het
Sptbn5 T C 2: 120,071,644 I126M possibly damaging Het
Strada A G 11: 106,171,221 V94A possibly damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Tcrg-C3 A T 13: 19,261,091 M70L probably damaging Het
Tgm1 T C 14: 55,704,941 Y651C probably damaging Het
Tmem200c T A 17: 68,840,617 V65E probably damaging Het
Tmem74 A T 15: 43,867,163 D161E probably benign Het
Vcan T G 13: 89,705,392 E483A probably damaging Het
Vmn2r124 A G 17: 18,063,174 T377A probably benign Het
Vmn2r3 A C 3: 64,259,394 I772S probably damaging Het
Wdfy3 A G 5: 101,915,376 V1342A probably benign Het
Zfp507 T C 7: 35,787,751 H764R probably damaging Het
Znrf3 A G 11: 5,287,455 I218T possibly damaging Het
Other mutations in Kcng4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Kcng4 APN 8 119626331 missense probably benign 0.00
IGL01360:Kcng4 APN 8 119625677 missense probably benign 0.40
IGL02094:Kcng4 APN 8 119633221 missense probably damaging 0.98
IGL02205:Kcng4 APN 8 119626083 missense probably damaging 0.99
IGL02892:Kcng4 APN 8 119633082 missense probably benign
IGL02927:Kcng4 APN 8 119626322 missense probably benign
IGL02954:Kcng4 APN 8 119633053 missense probably benign
IGL03143:Kcng4 APN 8 119625770 missense probably damaging 1.00
FR4449:Kcng4 UTSW 8 119633519 nonsense probably null
FR4548:Kcng4 UTSW 8 119633519 nonsense probably null
FR4737:Kcng4 UTSW 8 119633519 nonsense probably null
FR4976:Kcng4 UTSW 8 119633519 nonsense probably null
LCD18:Kcng4 UTSW 8 119633519 nonsense probably null
R0017:Kcng4 UTSW 8 119633520 missense probably damaging 1.00
R1777:Kcng4 UTSW 8 119633487 missense probably benign 0.02
R1967:Kcng4 UTSW 8 119632923 missense probably damaging 1.00
R3886:Kcng4 UTSW 8 119633247 missense probably benign 0.34
R4009:Kcng4 UTSW 8 119626085 missense probably damaging 1.00
R5137:Kcng4 UTSW 8 119625878 missense possibly damaging 0.88
R5792:Kcng4 UTSW 8 119626279 missense probably damaging 1.00
R5987:Kcng4 UTSW 8 119626359 missense probably damaging 1.00
R6339:Kcng4 UTSW 8 119632954 missense probably damaging 1.00
R6379:Kcng4 UTSW 8 119633620 nonsense probably null
R6430:Kcng4 UTSW 8 119633050 missense probably damaging 0.96
X0024:Kcng4 UTSW 8 119633367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGGACTCATTCTCAGCTAC -3'
(R):5'- CTTCGTGGTGGAATCCATCTG -3'

Sequencing Primer
(F):5'- TTCTCAGCTACATAGACCAACGGTG -3'
(R):5'- GGAATCCATCTGTGTGGCC -3'
Posted On2014-06-23