Mutagenetix > Incidental Mutation

Incidental Mutation 'R1923:Cubn'

213199

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin

Synonyms

D2Wsu88e, intrinsic factor-cobalamin receptor

MMRRC Submission

039941-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1923 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13281149-13496624 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13315337 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 3032 (Y3032C)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091436
AA Change: Y3032C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: Y3032C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149137

Meta Mutation Damage Score

0.6775

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 92.9%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	C	10: 78,903,743 (GRCm39)	E163G	probably damaging	Het
4921513D11Rik	A	G	17: 79,935,562 (GRCm39)		probably benign	Het
Acox3	T	A	5: 35,749,459 (GRCm39)	F195I	possibly damaging	Het
Acsl6	T	C	11: 54,216,417 (GRCm39)	Y135H	probably damaging	Het
Ankhd1	C	A	18: 36,781,083 (GRCm39)	A2045E	probably benign	Het
Ap5z1	A	G	5: 142,458,096 (GRCm39)	H423R	probably benign	Het
Arsk	T	A	13: 76,214,985 (GRCm39)		probably benign	Het
Bpi	G	A	2: 158,103,083 (GRCm39)	G76D	probably damaging	Het
Carmil3	A	G	14: 55,739,861 (GRCm39)	T983A	probably damaging	Het
Ccdc192	A	T	18: 57,666,959 (GRCm39)	D12V	probably damaging	Het
Chmp2b	A	T	16: 65,342,213 (GRCm39)	M125K	possibly damaging	Het
Clca3a2	T	A	3: 144,511,491 (GRCm39)	I26L	probably damaging	Het
Ehbp1	T	A	11: 22,101,850 (GRCm39)	D226V	probably damaging	Het
Enpp6	A	T	8: 47,535,541 (GRCm39)	D362V	probably damaging	Het
Fam53b	A	G	7: 132,317,521 (GRCm39)	S374P	probably damaging	Het
Fmn1	T	C	2: 113,260,066 (GRCm39)		probably benign	Het
Fndc7	C	T	3: 108,784,003 (GRCm39)	R202H	probably benign	Het
Frmd4b	T	G	6: 97,265,415 (GRCm39)	D951A	probably benign	Het
Git2	A	G	5: 114,877,162 (GRCm39)	Y107H	probably damaging	Het
Gm11595	A	T	11: 99,663,365 (GRCm39)	V105E	unknown	Het
Krt26	CTAGTA	CTA	11: 99,224,352 (GRCm39)		probably benign	Het
Lrriq4	C	A	3: 30,713,242 (GRCm39)	Q448K	probably benign	Het
Ly6g5c	A	G	17: 35,330,863 (GRCm39)	I128M	possibly damaging	Het
Mroh9	T	A	1: 162,903,860 (GRCm39)	S51C	probably damaging	Het
Myh3	A	G	11: 66,970,828 (GRCm39)	S2G	probably benign	Het
Nat8f4	A	G	6: 85,878,497 (GRCm39)	Y9H	probably damaging	Het
Negr1	T	C	3: 156,267,836 (GRCm39)	V2A	probably benign	Het
Or2y1	C	T	11: 49,386,131 (GRCm39)	T257I	probably damaging	Het
Or7g19	C	T	9: 18,856,781 (GRCm39)	T279I	probably benign	Het
Or8k32	T	G	2: 86,368,857 (GRCm39)	Y132S	probably damaging	Het
Otog	G	A	7: 45,895,707 (GRCm39)	C107Y	probably damaging	Het
Pdgfra	C	A	5: 75,324,394 (GRCm39)	T83K	probably benign	Het
Pdlim2	C	T	14: 70,402,228 (GRCm39)	R296H	probably damaging	Het
Retreg1	A	G	15: 25,969,924 (GRCm39)	D109G	probably damaging	Het
Rgs12	T	A	5: 35,189,613 (GRCm39)	W674R	probably damaging	Het
Rgs18	T	C	1: 144,631,818 (GRCm39)	D98G	possibly damaging	Het
Rnf146	A	G	10: 29,223,715 (GRCm39)	F57S	probably damaging	Het
Skic3	T	A	13: 76,282,889 (GRCm39)	V737D	probably damaging	Het
Slc22a20	C	A	19: 6,021,464 (GRCm39)	V513L	probably benign	Het
Stox2	G	T	8: 47,646,661 (GRCm39)	F266L	probably damaging	Het
Tbx21	C	T	11: 96,990,863 (GRCm39)	V272M	probably damaging	Het
Tmc7	A	G	7: 118,144,850 (GRCm39)	F570S	probably benign	Het
Tmem236	T	C	2: 14,224,117 (GRCm39)	I302T	probably damaging	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Trpm3	T	C	19: 22,862,776 (GRCm39)	L506S	probably damaging	Het
Uggt1	T	C	1: 36,218,694 (GRCm39)	I78V	probably damaging	Het
Xpo4	A	T	14: 57,828,328 (GRCm39)	V844D	probably damaging	Het
Zfp507	C	T	7: 35,493,150 (GRCm39)	R631Q	probably damaging	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13,496,631 (GRCm39)	unclassified	probably benign
IGL00228:Cubn	APN	2	13,461,508 (GRCm39)	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13,386,660 (GRCm39)	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13,431,867 (GRCm39)	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13,283,229 (GRCm39)	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13,287,730 (GRCm39)	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13,299,041 (GRCm39)	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13,472,521 (GRCm39)	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13,386,738 (GRCm39)	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13,461,434 (GRCm39)	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13,283,219 (GRCm39)	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13,482,904 (GRCm39)	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13,315,377 (GRCm39)	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13,470,719 (GRCm39)	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13,288,852 (GRCm39)	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13,355,673 (GRCm39)	splice site	probably benign
IGL01534:Cubn	APN	2	13,470,744 (GRCm39)	nonsense	probably null
IGL01584:Cubn	APN	2	13,313,472 (GRCm39)	splice site	probably benign
IGL01595:Cubn	APN	2	13,330,027 (GRCm39)	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13,311,085 (GRCm39)	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13,494,747 (GRCm39)	nonsense	probably null
IGL01972:Cubn	APN	2	13,450,883 (GRCm39)	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13,292,405 (GRCm39)	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13,344,657 (GRCm39)	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13,386,648 (GRCm39)	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13,432,645 (GRCm39)	splice site	probably null
IGL02491:Cubn	APN	2	13,326,039 (GRCm39)	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13,330,037 (GRCm39)	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13,450,843 (GRCm39)	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13,449,851 (GRCm39)	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13,299,181 (GRCm39)	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13,323,123 (GRCm39)	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13,291,905 (GRCm39)	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13,360,500 (GRCm39)	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13,431,778 (GRCm39)	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13,365,140 (GRCm39)	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13,482,868 (GRCm39)	splice site	probably null
mellow	UTSW	2	13,482,889 (GRCm39)	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13,473,663 (GRCm39)	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13,496,561 (GRCm39)	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13,311,243 (GRCm39)	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13,361,520 (GRCm39)	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13,480,846 (GRCm39)	critical splice donor site	probably null
R0254:Cubn	UTSW	2	13,445,325 (GRCm39)	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13,429,505 (GRCm39)	missense	probably benign	0.01
R0360:Cubn	UTSW	2	13,315,318 (GRCm39)	splice site	probably benign
R0364:Cubn	UTSW	2	13,315,318 (GRCm39)	splice site	probably benign
R0383:Cubn	UTSW	2	13,435,770 (GRCm39)	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13,474,575 (GRCm39)	missense	possibly damaging	0.87
R0419:Cubn	UTSW	2	13,474,574 (GRCm39)	missense	possibly damaging	0.77
R0498:Cubn	UTSW	2	13,449,078 (GRCm39)	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13,433,491 (GRCm39)	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13,365,063 (GRCm39)	splice site	probably null
R0735:Cubn	UTSW	2	13,496,500 (GRCm39)	splice site	probably benign
R0780:Cubn	UTSW	2	13,461,424 (GRCm39)	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13,367,139 (GRCm39)	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13,341,053 (GRCm39)	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13,449,811 (GRCm39)	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13,292,379 (GRCm39)	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13,365,130 (GRCm39)	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13,330,099 (GRCm39)	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13,330,099 (GRCm39)	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13,480,931 (GRCm39)	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13,431,916 (GRCm39)	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13,292,472 (GRCm39)	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13,432,778 (GRCm39)	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13,474,600 (GRCm39)	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13,494,128 (GRCm39)	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13,313,372 (GRCm39)	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13,327,813 (GRCm39)	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13,283,349 (GRCm39)	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13,344,828 (GRCm39)	splice site	probably null
R2021:Cubn	UTSW	2	13,313,360 (GRCm39)	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13,340,978 (GRCm39)	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13,449,189 (GRCm39)	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13,340,978 (GRCm39)	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13,323,053 (GRCm39)	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13,408,891 (GRCm39)	nonsense	probably null
R2369:Cubn	UTSW	2	13,496,028 (GRCm39)	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13,480,961 (GRCm39)	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13,323,083 (GRCm39)	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13,283,167 (GRCm39)	splice site	probably null
R2850:Cubn	UTSW	2	13,327,764 (GRCm39)	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13,435,645 (GRCm39)	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13,362,950 (GRCm39)	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13,367,158 (GRCm39)	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13,367,158 (GRCm39)	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13,362,973 (GRCm39)	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13,338,319 (GRCm39)	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13,336,396 (GRCm39)	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13,432,725 (GRCm39)	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13,365,164 (GRCm39)	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13,299,136 (GRCm39)	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13,287,819 (GRCm39)	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13,287,819 (GRCm39)	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13,291,791 (GRCm39)	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13,331,488 (GRCm39)	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13,318,810 (GRCm39)	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13,433,374 (GRCm39)	intron	probably benign
R4405:Cubn	UTSW	2	13,470,841 (GRCm39)	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13,433,560 (GRCm39)	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13,318,790 (GRCm39)	splice site	probably null
R4770:Cubn	UTSW	2	13,319,578 (GRCm39)	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13,291,835 (GRCm39)	missense	possibly damaging	0.94
R4799:Cubn	UTSW	2	13,355,869 (GRCm39)	missense	probably damaging	1.00
R4812:Cubn	UTSW	2	13,463,887 (GRCm39)	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13,330,036 (GRCm39)	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13,494,721 (GRCm39)	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13,352,856 (GRCm39)	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13,292,379 (GRCm39)	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13,483,013 (GRCm39)	nonsense	probably null
R5305:Cubn	UTSW	2	13,393,750 (GRCm39)	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13,496,506 (GRCm39)	splice site	probably null
R5530:Cubn	UTSW	2	13,313,334 (GRCm39)	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13,355,743 (GRCm39)	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13,393,702 (GRCm39)	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13,324,834 (GRCm39)	splice site	probably benign
R5923:Cubn	UTSW	2	13,490,889 (GRCm39)	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13,329,995 (GRCm39)	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13,329,995 (GRCm39)	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13,435,708 (GRCm39)	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13,432,658 (GRCm39)	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13,313,429 (GRCm39)	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13,354,687 (GRCm39)	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13,482,889 (GRCm39)	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13,285,006 (GRCm39)	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13,480,934 (GRCm39)	missense	probably damaging	0.98
R6368:Cubn	UTSW	2	13,435,806 (GRCm39)	missense	probably damaging	0.96
R6383:Cubn	UTSW	2	13,432,646 (GRCm39)	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13,360,491 (GRCm39)	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13,299,014 (GRCm39)	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13,463,813 (GRCm39)	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13,315,484 (GRCm39)	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13,435,683 (GRCm39)	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13,480,875 (GRCm39)	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13,326,066 (GRCm39)	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13,449,840 (GRCm39)	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13,449,064 (GRCm39)	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13,323,089 (GRCm39)	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13,352,840 (GRCm39)	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13,386,648 (GRCm39)	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13,491,600 (GRCm39)	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13,311,092 (GRCm39)	missense	probably benign	0.10
R7076:Cubn	UTSW	2	13,311,091 (GRCm39)	missense	probably benign	0.00
R7086:Cubn	UTSW	2	13,324,669 (GRCm39)	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13,347,309 (GRCm39)	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13,355,814 (GRCm39)	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13,429,550 (GRCm39)	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13,345,143 (GRCm39)	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13,473,582 (GRCm39)	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13,291,875 (GRCm39)	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13,431,778 (GRCm39)	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13,460,320 (GRCm39)	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13,494,728 (GRCm39)	missense	possibly damaging	0.74
R7699:Cubn	UTSW	2	13,352,989 (GRCm39)	missense	probably benign
R7700:Cubn	UTSW	2	13,494,728 (GRCm39)	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13,352,989 (GRCm39)	missense	probably benign
R7751:Cubn	UTSW	2	13,365,176 (GRCm39)	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13,284,889 (GRCm39)	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13,352,961 (GRCm39)	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13,473,680 (GRCm39)	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13,429,538 (GRCm39)	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13,337,166 (GRCm39)	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13,340,897 (GRCm39)	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13,483,989 (GRCm39)	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13,336,471 (GRCm39)	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13,393,659 (GRCm39)	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13,299,129 (GRCm39)	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13,354,688 (GRCm39)	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13,491,613 (GRCm39)	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13,311,274 (GRCm39)	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13,345,053 (GRCm39)	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13,435,658 (GRCm39)	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13,433,535 (GRCm39)	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13,329,971 (GRCm39)	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13,433,567 (GRCm39)	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13,386,610 (GRCm39)	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13,432,658 (GRCm39)	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13,318,855 (GRCm39)	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13,313,331 (GRCm39)	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13,388,770 (GRCm39)	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13,313,377 (GRCm39)	nonsense	probably null
R8874:Cubn	UTSW	2	13,365,157 (GRCm39)	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13,461,466 (GRCm39)	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13,291,914 (GRCm39)	missense	probably benign	0.02
R9143:Cubn	UTSW	2	13,337,276 (GRCm39)	splice site	probably benign
R9261:Cubn	UTSW	2	13,283,262 (GRCm39)	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13,386,703 (GRCm39)	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13,463,767 (GRCm39)	missense	probably damaging	0.99
R9603:Cubn	UTSW	2	13,292,510 (GRCm39)	missense	probably damaging	1.00
R9614:Cubn	UTSW	2	13,482,945 (GRCm39)	missense	probably benign	0.00
R9615:Cubn	UTSW	2	13,325,991 (GRCm39)	missense	possibly damaging	0.88
R9616:Cubn	UTSW	2	13,319,529 (GRCm39)	missense	probably benign	0.04
R9774:Cubn	UTSW	2	13,433,530 (GRCm39)	missense	probably benign
X0018:Cubn	UTSW	2	13,463,797 (GRCm39)	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13,480,887 (GRCm39)	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13,347,392 (GRCm39)	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13,327,773 (GRCm39)	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13,388,803 (GRCm39)	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13,299,040 (GRCm39)	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13,386,636 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGTAATTTTAGCCAAATTTCAGGGG -3'
(R):5'- CTGCGATTACGATGGCTTGC -3'

Sequencing Primer
(F):5'- GAGTGCTTTTAGCCACAGAGTCATC -3'
(R):5'- CGATGGCTTGCATATCATCAAAGGTC -3'

Posted On

2014-07-14