Incidental Mutation 'R1955:Kmt2b'
ID217673
Institutional Source Beutler Lab
Gene Symbol Kmt2b
Ensembl Gene ENSMUSG00000006307
Gene Namelysine (K)-specific methyltransferase 2B
Synonyms2610014H22Rik, Wbp7, Mll2
MMRRC Submission 039969-MU
Accession Numbers

Genbank: NM_029274; MGI: 109565

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1955 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30568858-30588726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30575351 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1976 (M1976K)
Ref Sequence ENSEMBL: ENSMUSP00000103789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006470] [ENSMUST00000108154]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006470
AA Change: M1985K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006470
Gene: ENSMUSG00000006307
AA Change: M1985K

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 7.2e-15 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1881 1899 N/A INTRINSIC
low complexity region 1912 1942 N/A INTRINSIC
low complexity region 1961 1978 N/A INTRINSIC
low complexity region 1991 2003 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2048 2061 N/A INTRINSIC
low complexity region 2087 2105 N/A INTRINSIC
low complexity region 2127 2138 N/A INTRINSIC
low complexity region 2215 2235 N/A INTRINSIC
low complexity region 2239 2270 N/A INTRINSIC
low complexity region 2396 2406 N/A INTRINSIC
FYRC 2419 2504 4.83e-36 SMART
SET 2581 2703 1.67e-42 SMART
PostSET 2705 2721 4.65e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108154
AA Change: M1976K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103789
Gene: ENSMUSG00000006307
AA Change: M1976K

DomainStartEndE-ValueType
AT_hook 18 30 2.82e2 SMART
low complexity region 66 106 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
AT_hook 149 159 2.4e2 SMART
AT_hook 218 230 1.95e2 SMART
low complexity region 249 263 N/A INTRINSIC
low complexity region 272 302 N/A INTRINSIC
coiled coil region 353 413 N/A INTRINSIC
AT_hook 476 488 5.47e-1 SMART
low complexity region 501 517 N/A INTRINSIC
low complexity region 578 606 N/A INTRINSIC
low complexity region 621 657 N/A INTRINSIC
low complexity region 673 700 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 738 777 N/A INTRINSIC
low complexity region 910 922 N/A INTRINSIC
Pfam:zf-CXXC 963 1010 1e-14 PFAM
low complexity region 1039 1061 N/A INTRINSIC
low complexity region 1103 1115 N/A INTRINSIC
PHD 1209 1256 1.25e-5 SMART
PHD 1257 1307 5.4e-10 SMART
PHD 1343 1400 1.27e-6 SMART
low complexity region 1415 1427 N/A INTRINSIC
PHD 1646 1692 3.82e-1 SMART
FYRN 1745 1788 3.25e-19 SMART
low complexity region 1872 1890 N/A INTRINSIC
low complexity region 1903 1933 N/A INTRINSIC
low complexity region 1952 1969 N/A INTRINSIC
low complexity region 1982 1994 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2039 2052 N/A INTRINSIC
low complexity region 2078 2096 N/A INTRINSIC
low complexity region 2118 2129 N/A INTRINSIC
low complexity region 2206 2226 N/A INTRINSIC
low complexity region 2230 2261 N/A INTRINSIC
low complexity region 2383 2398 N/A INTRINSIC
FYRC 2411 2496 4.83e-36 SMART
SET 2573 2695 1.67e-42 SMART
PostSET 2697 2713 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128456
Predicted Effect unknown
Transcript: ENSMUST00000131002
AA Change: M1276K
SMART Domains Protein: ENSMUSP00000118486
Gene: ENSMUSG00000006307
AA Change: M1276K

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 30 69 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Pfam:zf-CXXC 255 302 5.2e-15 PFAM
low complexity region 331 353 N/A INTRINSIC
low complexity region 395 407 N/A INTRINSIC
PHD 501 548 1.25e-5 SMART
PHD 549 599 5.4e-10 SMART
PHD 635 692 1.27e-6 SMART
low complexity region 707 719 N/A INTRINSIC
PHD 938 984 3.82e-1 SMART
FYRN 1037 1080 3.25e-19 SMART
low complexity region 1173 1191 N/A INTRINSIC
low complexity region 1204 1234 N/A INTRINSIC
low complexity region 1253 1270 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
low complexity region 1305 1318 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1379 1397 N/A INTRINSIC
low complexity region 1419 1430 N/A INTRINSIC
low complexity region 1507 1527 N/A INTRINSIC
low complexity region 1531 1562 N/A INTRINSIC
low complexity region 1684 1699 N/A INTRINSIC
FYRC 1712 1797 4.83e-36 SMART
SET 1874 1996 1.67e-42 SMART
PostSET 1998 2014 4.65e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152931
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains multiple domains including a CXXC zinc finger, three PHD zinc fingers, two FY-rich domains, and a SET (suppressor of variegation, enhancer of zeste, and trithorax) domain. The SET domain is a conserved C-terminal domain that characterizes proteins of the MLL (mixed-lineage leukemia) family. This gene is ubiquitously expressed in adult tissues. It is also amplified in solid tumor cell lines, and may be involved in human cancer. Two alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene, however, the full length nature of the shorter transcript is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic growth retardation, abnormal somite development, neural tube defects, increased apoptosis, and complete embryonic lethality. Homozygotes for a hypomorphic allele show embryonic growth arrest, altered DNA methylation, and reduced female fertility. [provided by MGI curators]
Allele List at MGI

 All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T A 1: 53,163,241 K128N probably benign Het
4930430F08Rik A G 10: 100,577,304 V91A probably damaging Het
Acadm A C 3: 153,929,551 F309V probably damaging Het
Adam6b C A 12: 113,491,816 A751E probably benign Het
Adcy9 A G 16: 4,418,659 I296T possibly damaging Het
Arhgap45 A G 10: 80,026,492 E471G probably benign Het
Atcay T C 10: 81,214,793 D96G possibly damaging Het
B3galt4 T A 17: 33,950,632 R211* probably null Het
Bpi T C 2: 158,274,715 I344T probably damaging Het
Btnl4 T C 17: 34,472,930 K233E possibly damaging Het
Cars2 A T 8: 11,550,286 Y68N probably damaging Het
Cd207 T A 6: 83,671,775 R302W probably benign Het
Cdc5l T C 17: 45,426,516 probably null Het
Chaf1a C T 17: 56,047,540 T270I unknown Het
Col4a1 C T 8: 11,208,228 probably null Het
Col7a1 G T 9: 108,955,664 V187L unknown Het
Cry1 G A 10: 85,144,178 T422I probably benign Het
Csgalnact1 C T 8: 68,372,667 V392I probably benign Het
Cyp2c38 A G 19: 39,404,687 L312P probably damaging Het
Ddx20 G A 3: 105,679,562 T489M possibly damaging Het
Decr1 A T 4: 15,924,256 N221K probably benign Het
Dennd4a A T 9: 64,852,467 T285S probably benign Het
Dgka A G 10: 128,730,189 probably null Het
Dmd A T X: 83,878,557 M1478L probably benign Het
Dvl1 G A 4: 155,858,029 R584Q possibly damaging Het
Dync1li1 A T 9: 114,721,746 S450C probably damaging Het
Ehbp1l1 A G 19: 5,710,669 V1558A possibly damaging Het
Esr1 T A 10: 4,857,125 M347K probably damaging Het
F2 T A 2: 91,633,095 H148L probably benign Het
Fezf2 T C 14: 12,342,644 N407S probably benign Het
Fscn3 T A 6: 28,430,236 M135K possibly damaging Het
Ganab T G 19: 8,911,616 Y560* probably null Het
Garem2 T C 5: 30,108,270 V44A probably benign Het
Gja4 A G 4: 127,312,449 W174R probably damaging Het
Gja5 A T 3: 97,051,641 H338L probably benign Het
Gm43517 A G 12: 49,389,889 probably benign Het
Gm5434 A G 12: 36,090,596 probably benign Het
Iqch A T 9: 63,548,016 D166E probably benign Het
Kifc5b T A 17: 26,926,297 probably null Het
Leng1 A T 7: 3,665,416 V11D probably damaging Het
Lrit3 A G 3: 129,800,481 V149A probably benign Het
Lrpap1 A G 5: 35,102,412 L114P probably damaging Het
Marveld3 T A 8: 109,959,748 D162V probably benign Het
Mon2 A T 10: 123,038,483 I320N probably damaging Het
Morc2b T C 17: 33,137,490 Y436C probably damaging Het
Myo7a A T 7: 98,054,921 V1928D probably damaging Het
Ncoa6 A G 2: 155,406,821 V1521A possibly damaging Het
Nexmif A G X: 104,083,953 S1453P possibly damaging Het
Nudt16l1 A G 16: 4,940,325 M182V probably benign Het
Obp2b A T 2: 25,738,551 I106L probably benign Het
Olfr1129 T A 2: 87,576,005 L307Q probably damaging Het
Olfr1239 T A 2: 89,418,411 M1L probably damaging Het
Olfr186 T A 16: 59,027,411 R165S probably damaging Het
Olfr902 T C 9: 38,449,688 I272T probably benign Het
Parl T A 16: 20,302,327 M1L possibly damaging Het
Pde7a G A 3: 19,227,799 A429V probably damaging Het
Pkd1l2 T A 8: 117,043,361 M1119L probably benign Het
Plch1 C T 3: 63,755,267 V272I probably damaging Het
Plekha4 G A 7: 45,553,906 G740D probably damaging Het
Pnliprp1 A G 19: 58,734,972 D265G possibly damaging Het
Pola1 A C X: 93,597,261 V384G probably damaging Het
Pon3 T A 6: 5,230,774 D251V probably benign Het
Pot1b A G 17: 55,674,067 C316R possibly damaging Het
Prkaca T A 8: 83,988,317 V116E probably damaging Het
Prpf6 T G 2: 181,632,077 M338R probably benign Het
Rasgef1c A G 11: 49,975,715 H382R possibly damaging Het
Rps25 C T 9: 44,410,008 T113I probably benign Het
Serpinb1b G T 13: 33,085,439 A52S probably benign Het
Sh3yl1 A G 12: 30,922,333 K34E possibly damaging Het
Siah2 C T 3: 58,676,097 R256Q probably damaging Het
Slc24a2 A G 4: 87,073,244 L404P probably damaging Het
Slc28a2 G A 2: 122,447,866 C122Y probably benign Het
Slc4a8 T C 15: 100,807,376 I821T probably damaging Het
Slc5a3 T C 16: 92,077,874 V273A possibly damaging Het
Spag7 T C 11: 70,665,018 Q61R probably benign Het
Syt7 A T 19: 10,418,038 I71F probably damaging Het
Tars2 T C 3: 95,747,454 N413S probably damaging Het
Tex14 T A 11: 87,509,621 L413Q probably damaging Het
Tjp3 T C 10: 81,277,999 E475G probably damaging Het
Tmem131l A G 3: 83,961,544 S175P probably damaging Het
Tmem144 C T 3: 79,826,857 V180M probably benign Het
Tmem200c A T 17: 68,840,961 I180F probably damaging Het
Tmem232 G T 17: 65,484,487 H129N probably benign Het
Tmprss11g T A 5: 86,498,532 I59F probably damaging Het
Tmprss2 T A 16: 97,567,177 probably null Het
Tor1aip2 T A 1: 156,051,842 probably benign Het
Trim61 T C 8: 65,013,392 I406V possibly damaging Het
Trpv5 T C 6: 41,657,937 D486G probably damaging Het
Try5 T C 6: 41,311,769 E64G probably benign Het
Txlnb A G 10: 17,799,420 E107G probably damaging Het
Uckl1 T C 2: 181,570,527 Q332R probably benign Het
Ugt2b1 T C 5: 86,917,713 Y489C probably damaging Het
Ugt2b5 T A 5: 87,127,772 M407L probably benign Het
Vmn1r191 A T 13: 22,178,815 S256R possibly damaging Het
Vps13b T G 15: 35,925,408 probably null Het
Vps13d A G 4: 145,156,143 F960S probably damaging Het
Xab2 T A 8: 3,616,094 D227V probably damaging Het
Xaf1 A T 11: 72,306,606 D136V possibly damaging Het
Zan A G 5: 137,389,283 S4889P unknown Het
Zfp78 A G 7: 6,378,559 T203A probably benign Het
Zfp821 T C 8: 109,721,242 S72P probably damaging Het
Other mutations in Kmt2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Kmt2b APN 7 30586513 unclassified probably benign
IGL00821:Kmt2b APN 7 30570613 missense probably damaging 1.00
IGL00985:Kmt2b APN 7 30579927 missense probably damaging 1.00
IGL01092:Kmt2b APN 7 30580507 missense probably damaging 1.00
IGL01933:Kmt2b APN 7 30569514 critical splice donor site probably null
IGL01949:Kmt2b APN 7 30577161 splice site probably null
IGL02253:Kmt2b APN 7 30581727 missense probably damaging 1.00
IGL02455:Kmt2b APN 7 30578878 critical splice donor site probably null
IGL02493:Kmt2b APN 7 30569511 unclassified probably benign
IGL02504:Kmt2b APN 7 30586543 unclassified probably benign
IGL02532:Kmt2b APN 7 30586889 unclassified probably benign
IGL02698:Kmt2b APN 7 30578693 splice site probably benign
IGL02717:Kmt2b APN 7 30583444 missense probably damaging 1.00
IGL02826:Kmt2b APN 7 30577144 missense probably damaging 1.00
IGL02966:Kmt2b APN 7 30575462 missense probably benign 0.02
IGL03386:Kmt2b APN 7 30573971 missense possibly damaging 0.94
3-1:Kmt2b UTSW 7 30569615 nonsense probably null
FR4304:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586363 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4340:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4342:Kmt2b UTSW 7 30586375 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4449:Kmt2b UTSW 7 30586369 unclassified probably benign
FR4548:Kmt2b UTSW 7 30586380 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586361 unclassified probably benign
FR4589:Kmt2b UTSW 7 30586364 nonsense probably null
FR4589:Kmt2b UTSW 7 30586381 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586367 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586370 unclassified probably benign
FR4737:Kmt2b UTSW 7 30586378 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586360 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586362 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586364 nonsense probably null
FR4976:Kmt2b UTSW 7 30586366 unclassified probably benign
FR4976:Kmt2b UTSW 7 30586373 unclassified probably benign
R0057:Kmt2b UTSW 7 30576792 splice site probably benign
R0131:Kmt2b UTSW 7 30583921 missense probably damaging 0.99
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0241:Kmt2b UTSW 7 30577069 missense probably damaging 1.00
R0377:Kmt2b UTSW 7 30574193 missense probably damaging 1.00
R0396:Kmt2b UTSW 7 30576755 missense probably damaging 1.00
R1241:Kmt2b UTSW 7 30574940 missense probably damaging 0.98
R1252:Kmt2b UTSW 7 30580487 missense probably damaging 0.99
R1418:Kmt2b UTSW 7 30576960 splice site probably benign
R1599:Kmt2b UTSW 7 30570575 missense probably damaging 1.00
R1632:Kmt2b UTSW 7 30583962 missense probably damaging 1.00
R1745:Kmt2b UTSW 7 30585850 missense possibly damaging 0.90
R1867:Kmt2b UTSW 7 30574658 missense possibly damaging 0.71
R2040:Kmt2b UTSW 7 30569420 missense probably damaging 1.00
R2113:Kmt2b UTSW 7 30583387 missense probably damaging 1.00
R2216:Kmt2b UTSW 7 30574065 missense probably benign 0.25
R2401:Kmt2b UTSW 7 30576708 missense probably damaging 1.00
R2518:Kmt2b UTSW 7 30576068 missense probably benign 0.10
R3436:Kmt2b UTSW 7 30576692 missense probably damaging 1.00
R4248:Kmt2b UTSW 7 30574064 missense probably benign 0.25
R4259:Kmt2b UTSW 7 30581081 missense probably damaging 0.99
R4290:Kmt2b UTSW 7 30581836 critical splice donor site probably null
R4388:Kmt2b UTSW 7 30588590 unclassified probably benign
R4542:Kmt2b UTSW 7 30580259 missense probably damaging 0.99
R4649:Kmt2b UTSW 7 30586358 unclassified probably benign
R4722:Kmt2b UTSW 7 30583202 missense probably damaging 1.00
R4891:Kmt2b UTSW 7 30576761 nonsense probably null
R4916:Kmt2b UTSW 7 30578517 missense probably damaging 0.99
R5104:Kmt2b UTSW 7 30569840 missense probably damaging 1.00
R5254:Kmt2b UTSW 7 30569175 missense probably damaging 1.00
R5262:Kmt2b UTSW 7 30569794 missense probably damaging 1.00
R5307:Kmt2b UTSW 7 30581673 missense possibly damaging 0.91
R5526:Kmt2b UTSW 7 30580444 missense probably damaging 1.00
R5609:Kmt2b UTSW 7 30577145 missense probably damaging 0.99
R6150:Kmt2b UTSW 7 30588477 unclassified probably benign
R6727:Kmt2b UTSW 7 30584559 missense probably damaging 0.98
R6824:Kmt2b UTSW 7 30586276 unclassified probably benign
R7048:Kmt2b UTSW 7 30569306 missense probably damaging 0.99
X0067:Kmt2b UTSW 7 30579573 missense probably damaging 0.99
Z1088:Kmt2b UTSW 7 30585251 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGAAGGCAGGTCTTCAGGAG -3'
(R):5'- AGACTCGGACTTTCCAGCTC -3'

Sequencing Primer
(F):5'- TTGTTGGACAGCCTCAGC -3'
(R):5'- GGACTTTCCAGCTCCCCCAAG -3'
Posted On2014-08-01