Incidental Mutation 'R1955:Pkd1l2'
ID217684
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Namepolycystic kidney disease 1 like 2
Synonyms
MMRRC Submission 039969-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1955 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location116995679-117082449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117043361 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1119 (M1119L)
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]
Predicted Effect probably benign
Transcript: ENSMUST00000098375
AA Change: M1118L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416
AA Change: M1118L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109093
AA Change: M1119L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416
AA Change: M1119L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153724
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T A 1: 53,163,241 K128N probably benign Het
4930430F08Rik A G 10: 100,577,304 V91A probably damaging Het
Acadm A C 3: 153,929,551 F309V probably damaging Het
Adam6b C A 12: 113,491,816 A751E probably benign Het
Adcy9 A G 16: 4,418,659 I296T possibly damaging Het
Arhgap45 A G 10: 80,026,492 E471G probably benign Het
Atcay T C 10: 81,214,793 D96G possibly damaging Het
B3galt4 T A 17: 33,950,632 R211* probably null Het
Bpi T C 2: 158,274,715 I344T probably damaging Het
Btnl4 T C 17: 34,472,930 K233E possibly damaging Het
Cars2 A T 8: 11,550,286 Y68N probably damaging Het
Cd207 T A 6: 83,671,775 R302W probably benign Het
Cdc5l T C 17: 45,426,516 probably null Het
Chaf1a C T 17: 56,047,540 T270I unknown Het
Col4a1 C T 8: 11,208,228 probably null Het
Col7a1 G T 9: 108,955,664 V187L unknown Het
Cry1 G A 10: 85,144,178 T422I probably benign Het
Csgalnact1 C T 8: 68,372,667 V392I probably benign Het
Cyp2c38 A G 19: 39,404,687 L312P probably damaging Het
Ddx20 G A 3: 105,679,562 T489M possibly damaging Het
Decr1 A T 4: 15,924,256 N221K probably benign Het
Dennd4a A T 9: 64,852,467 T285S probably benign Het
Dgka A G 10: 128,730,189 probably null Het
Dmd A T X: 83,878,557 M1478L probably benign Het
Dvl1 G A 4: 155,858,029 R584Q possibly damaging Het
Dync1li1 A T 9: 114,721,746 S450C probably damaging Het
Ehbp1l1 A G 19: 5,710,669 V1558A possibly damaging Het
Esr1 T A 10: 4,857,125 M347K probably damaging Het
F2 T A 2: 91,633,095 H148L probably benign Het
Fezf2 T C 14: 12,342,644 N407S probably benign Het
Fscn3 T A 6: 28,430,236 M135K possibly damaging Het
Ganab T G 19: 8,911,616 Y560* probably null Het
Garem2 T C 5: 30,108,270 V44A probably benign Het
Gja4 A G 4: 127,312,449 W174R probably damaging Het
Gja5 A T 3: 97,051,641 H338L probably benign Het
Gm43517 A G 12: 49,389,889 probably benign Het
Gm5434 A G 12: 36,090,596 probably benign Het
Iqch A T 9: 63,548,016 D166E probably benign Het
Kifc5b T A 17: 26,926,297 probably null Het
Kmt2b A T 7: 30,575,351 M1976K possibly damaging Het
Leng1 A T 7: 3,665,416 V11D probably damaging Het
Lrit3 A G 3: 129,800,481 V149A probably benign Het
Lrpap1 A G 5: 35,102,412 L114P probably damaging Het
Marveld3 T A 8: 109,959,748 D162V probably benign Het
Mon2 A T 10: 123,038,483 I320N probably damaging Het
Morc2b T C 17: 33,137,490 Y436C probably damaging Het
Myo7a A T 7: 98,054,921 V1928D probably damaging Het
Ncoa6 A G 2: 155,406,821 V1521A possibly damaging Het
Nexmif A G X: 104,083,953 S1453P possibly damaging Het
Nudt16l1 A G 16: 4,940,325 M182V probably benign Het
Obp2b A T 2: 25,738,551 I106L probably benign Het
Olfr1129 T A 2: 87,576,005 L307Q probably damaging Het
Olfr1239 T A 2: 89,418,411 M1L probably damaging Het
Olfr186 T A 16: 59,027,411 R165S probably damaging Het
Olfr902 T C 9: 38,449,688 I272T probably benign Het
Parl T A 16: 20,302,327 M1L possibly damaging Het
Pde7a G A 3: 19,227,799 A429V probably damaging Het
Plch1 C T 3: 63,755,267 V272I probably damaging Het
Plekha4 G A 7: 45,553,906 G740D probably damaging Het
Pnliprp1 A G 19: 58,734,972 D265G possibly damaging Het
Pola1 A C X: 93,597,261 V384G probably damaging Het
Pon3 T A 6: 5,230,774 D251V probably benign Het
Pot1b A G 17: 55,674,067 C316R possibly damaging Het
Prkaca T A 8: 83,988,317 V116E probably damaging Het
Prpf6 T G 2: 181,632,077 M338R probably benign Het
Rasgef1c A G 11: 49,975,715 H382R possibly damaging Het
Rps25 C T 9: 44,410,008 T113I probably benign Het
Serpinb1b G T 13: 33,085,439 A52S probably benign Het
Sh3yl1 A G 12: 30,922,333 K34E possibly damaging Het
Siah2 C T 3: 58,676,097 R256Q probably damaging Het
Slc24a2 A G 4: 87,073,244 L404P probably damaging Het
Slc28a2 G A 2: 122,447,866 C122Y probably benign Het
Slc4a8 T C 15: 100,807,376 I821T probably damaging Het
Slc5a3 T C 16: 92,077,874 V273A possibly damaging Het
Spag7 T C 11: 70,665,018 Q61R probably benign Het
Syt7 A T 19: 10,418,038 I71F probably damaging Het
Tars2 T C 3: 95,747,454 N413S probably damaging Het
Tex14 T A 11: 87,509,621 L413Q probably damaging Het
Tjp3 T C 10: 81,277,999 E475G probably damaging Het
Tmem131l A G 3: 83,961,544 S175P probably damaging Het
Tmem144 C T 3: 79,826,857 V180M probably benign Het
Tmem200c A T 17: 68,840,961 I180F probably damaging Het
Tmem232 G T 17: 65,484,487 H129N probably benign Het
Tmprss11g T A 5: 86,498,532 I59F probably damaging Het
Tmprss2 T A 16: 97,567,177 probably null Het
Tor1aip2 T A 1: 156,051,842 probably benign Het
Trim61 T C 8: 65,013,392 I406V possibly damaging Het
Trpv5 T C 6: 41,657,937 D486G probably damaging Het
Try5 T C 6: 41,311,769 E64G probably benign Het
Txlnb A G 10: 17,799,420 E107G probably damaging Het
Uckl1 T C 2: 181,570,527 Q332R probably benign Het
Ugt2b1 T C 5: 86,917,713 Y489C probably damaging Het
Ugt2b5 T A 5: 87,127,772 M407L probably benign Het
Vmn1r191 A T 13: 22,178,815 S256R possibly damaging Het
Vps13b T G 15: 35,925,408 probably null Het
Vps13d A G 4: 145,156,143 F960S probably damaging Het
Xab2 T A 8: 3,616,094 D227V probably damaging Het
Xaf1 A T 11: 72,306,606 D136V possibly damaging Het
Zan A G 5: 137,389,283 S4889P unknown Het
Zfp78 A G 7: 6,378,559 T203A probably benign Het
Zfp821 T C 8: 109,721,242 S72P probably damaging Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117059520 nonsense probably null
IGL01353:Pkd1l2 APN 8 117057443 missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117021856 missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117059592 missense probably benign
IGL01672:Pkd1l2 APN 8 117080732 missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117056387 missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 116998174 missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117060525 missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117016916 missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117009564 splice site probably benign
IGL02381:Pkd1l2 APN 8 117035800 splice site probably benign
IGL02416:Pkd1l2 APN 8 117040835 missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117040666 missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117029559 missense probably benign
IGL02861:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117013891 missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117024091 missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 116995809 missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117065745 missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117022022 missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117050048 splice site probably benign
R0309:Pkd1l2 UTSW 8 116997576 missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117021850 missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117082260 missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117082218 missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117051100 missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117076177 missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117044492 missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117019543 critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117054934 missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117065497 splice site probably benign
R1491:Pkd1l2 UTSW 8 117028408 missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117046159 missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117065500 splice site probably null
R1544:Pkd1l2 UTSW 8 117038235 frame shift probably null
R1558:Pkd1l2 UTSW 8 117082252 missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117040775 missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117056419 missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117030719 missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117046182 nonsense probably null
R1957:Pkd1l2 UTSW 8 117030682 missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117043231 critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117019533 missense probably benign
R2046:Pkd1l2 UTSW 8 116999955 missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117081469 missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117030722 missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117056325 missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117043317 missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117019494 missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117065551 missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117068315 critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117040739 missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117019429 missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117011575 missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117054885 missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117072549 missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117047374 splice site probably null
R5057:Pkd1l2 UTSW 8 117055008 missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117056442 missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117035118 missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117030649 missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117065830 missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117068116 missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117040783 nonsense probably null
R5610:Pkd1l2 UTSW 8 117042320 missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117055018 missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117065746 missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117055011 missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 116997582 missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117029648 missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117024056 missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117013987 missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117082368 missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117081470 missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117035847 missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117040666 missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117030631 missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117013942 missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117076131 nonsense probably null
R7148:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117040835 missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 116995797 missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117024034 missense probably benign
R7382:Pkd1l2 UTSW 8 117054871 missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117035902 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTGTCAGGGATGCACTGAG -3'
(R):5'- CGGCCTCTGCAAACGATATC -3'

Sequencing Primer
(F):5'- TGCTCCCAAACCAAGCTGGAG -3'
(R):5'- CTCTGCAAACGATATCTCTGGAAAG -3'
Posted On2014-08-01