Incidental Mutation 'R1957:Sept4'
ID217949
Institutional Source Beutler Lab
Gene Symbol Sept4
Ensembl Gene ENSMUSG00000020486
Gene Nameseptin 4
Synonymscell division control-related protein 2b, ARTS, Pnutl2, septin H5, Bh5
MMRRC Submission 039971-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.717) question?
Stock #R1957 (G1)
Quality Score168
Status Validated
Chromosome11
Chromosomal Location87568903-87590539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87590367 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 378 (T378A)
Ref Sequence ENSEMBL: ENSMUSP00000060127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018544] [ENSMUST00000063156] [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000107960] [ENSMUST00000107961] [ENSMUST00000107962] [ENSMUST00000119628] [ENSMUST00000122067] [ENSMUST00000123105] [ENSMUST00000133202] [ENSMUST00000146871]
Predicted Effect probably benign
Transcript: ENSMUST00000018544
AA Change: T477A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000018544
Gene: ENSMUSG00000020486
AA Change: T477A

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.8e-130 PFAM
Pfam:MMR_HSR1 146 290 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063156
AA Change: T378A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000060127
Gene: ENSMUSG00000020486
AA Change: T378A

DomainStartEndE-ValueType
Pfam:DUF258 26 142 7.5e-7 PFAM
Pfam:Septin 42 322 7.5e-131 PFAM
Pfam:MMR_HSR1 47 211 5.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092802
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103179
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107960
SMART Domains Protein: ENSMUSP00000103594
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.1e-130 PFAM
Pfam:MMR_HSR1 146 293 7.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107961
SMART Domains Protein: ENSMUSP00000103595
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
Pfam:DUF258 19 135 1e-7 PFAM
Pfam:Septin 35 232 1.9e-89 PFAM
Pfam:MMR_HSR1 40 204 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107962
AA Change: T458A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000103596
Gene: ENSMUSG00000020486
AA Change: T458A

DomainStartEndE-ValueType
low complexity region 75 89 N/A INTRINSIC
Pfam:Septin 122 402 1.3e-130 PFAM
Pfam:MMR_HSR1 127 273 8.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119628
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122067
SMART Domains Protein: ENSMUSP00000112960
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
Pfam:DUF258 8 124 5.3e-7 PFAM
Pfam:Septin 23 303 3.9e-131 PFAM
Pfam:MMR_HSR1 28 172 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123081
Predicted Effect probably benign
Transcript: ENSMUST00000123105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132723
Predicted Effect probably benign
Transcript: ENSMUST00000133202
SMART Domains Protein: ENSMUSP00000115790
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 84 98 N/A INTRINSIC
Pfam:DUF258 114 232 1.4e-7 PFAM
Pfam:Septin 131 280 1.2e-72 PFAM
Pfam:MMR_HSR1 136 279 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143950
Predicted Effect probably benign
Transcript: ENSMUST00000146871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148216
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C T 15: 102,338,633 probably benign Het
Abce1 A G 8: 79,685,949 I583T probably benign Het
Adcy1 A T 11: 7,161,945 T937S probably benign Het
Adgra2 A G 8: 27,111,168 I279V possibly damaging Het
Adgrl4 A T 3: 151,510,779 N533I possibly damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Amelx A T X: 169,182,157 probably null Het
Anks1b A T 10: 90,049,930 T163S probably damaging Het
Apc A G 18: 34,317,335 E2394G probably damaging Het
Arhgef39 C T 4: 43,499,309 G56E probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arsj A G 3: 126,439,021 N472S probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
B3gat1 A T 9: 26,755,952 D160V possibly damaging Het
Bmp7 T C 2: 172,939,921 E50G probably damaging Het
Bms1 T C 6: 118,392,978 E869G probably damaging Het
Brd4 G A 17: 32,221,366 P332L possibly damaging Het
Btbd11 T C 10: 85,633,699 L828P probably damaging Het
C130074G19Rik T C 1: 184,882,898 T32A probably benign Het
C1rl A T 6: 124,509,062 Y464F probably damaging Het
Ccdc150 T A 1: 54,263,909 M193K probably benign Het
Ccdc7a A G 8: 128,980,135 S338P probably damaging Het
Cenpu T C 8: 46,572,837 probably benign Het
Cep170 A C 1: 176,769,447 V448G probably benign Het
Col27a1 G T 4: 63,277,794 A879S probably benign Het
Crtac1 C T 19: 42,287,944 S515N possibly damaging Het
Cstad G A 2: 30,608,281 V43M unknown Het
Daam1 T C 12: 71,982,755 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dsg3 A G 18: 20,522,105 N153S probably damaging Het
Dzip3 C A 16: 48,927,593 L1151F probably damaging Het
Eml5 A T 12: 98,859,961 H644Q probably damaging Het
Emsy A G 7: 98,647,820 L52P probably damaging Het
Eno1 T A 4: 150,246,775 probably null Het
Epha3 T A 16: 63,772,952 T258S probably benign Het
Ern1 T C 11: 106,426,897 T134A probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fam151b T A 13: 92,477,903 T26S probably damaging Het
Fat1 T C 8: 45,040,682 V3955A probably damaging Het
Fbn1 T C 2: 125,367,654 N930S possibly damaging Het
Fgr A G 4: 132,998,362 M361V probably benign Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Fndc7 G A 3: 108,883,509 T67I probably damaging Het
Fxr2 A G 11: 69,643,940 T216A probably benign Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm438 G A 4: 144,777,819 T254I possibly damaging Het
Gm5174 A T 10: 86,656,753 noncoding transcript Het
Gm5431 A T 11: 48,888,397 L844* probably null Het
Gm6489 T C 1: 31,287,371 noncoding transcript Het
Gm9833 G T 3: 10,089,286 V372F probably benign Het
Gna11 A G 10: 81,530,844 V344A probably damaging Het
Gtpbp3 A G 8: 71,490,455 E170G probably damaging Het
H2afz A C 3: 137,865,514 probably benign Het
Heatr1 A G 13: 12,396,538 N87D probably damaging Het
Iars2 T C 1: 185,295,671 K687E possibly damaging Het
Ica1 T C 6: 8,749,736 D71G possibly damaging Het
Ifnlr1 T C 4: 135,686,570 L10P probably damaging Het
Il1r1 T A 1: 40,313,140 L490* probably null Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itgbl1 T A 14: 123,966,678 F394I probably damaging Het
Kat6b T C 14: 21,628,879 Y437H probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Krt27 A T 11: 99,346,483 probably null Het
Mki67 A T 7: 135,698,399 D1635E probably benign Het
Mmp23 G T 4: 155,652,052 H177Q possibly damaging Het
Mylk2 C A 2: 152,917,607 Q406K possibly damaging Het
Myo1g A G 11: 6,512,159 probably null Het
Myrf T C 19: 10,219,796 T261A probably benign Het
Nmt2 C T 2: 3,325,382 P486L possibly damaging Het
Oard1 T A 17: 48,415,276 L100* probably null Het
Oca2 T C 7: 56,321,498 I391T possibly damaging Het
Olfr181 T A 16: 58,926,167 M135L probably benign Het
Olfr488 A C 7: 108,255,196 L314* probably null Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr780 A T 10: 129,321,871 I83F possibly damaging Het
Olfr826 C A 10: 130,179,978 A301S possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Pabpc4 T A 4: 123,286,865 S127T probably damaging Het
Pcdhb1 A G 18: 37,265,707 D237G probably damaging Het
Pdcd6ip T C 9: 113,708,022 Y29C probably damaging Het
Phf3 C A 1: 30,831,520 R95L probably damaging Het
Pkd1l2 A T 8: 117,030,682 V1539D probably damaging Het
Plxna1 A T 6: 89,331,291 D1271E probably damaging Het
Ppp3r2 A G 4: 49,681,726 F75L probably damaging Het
Pth2r C A 1: 65,372,355 D350E probably damaging Het
Rabgap1 T C 2: 37,483,762 F262S possibly damaging Het
Rbbp6 T C 7: 122,990,288 S438P probably benign Het
Rexo1 G A 10: 80,543,366 R1038C probably damaging Het
Rnf10 A G 5: 115,260,322 probably benign Het
Scyl1 C A 19: 5,760,104 A565S probably benign Het
Sh3yl1 A G 12: 30,942,788 probably null Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc32a1 T C 2: 158,614,043 V206A probably damaging Het
Smyd5 G A 6: 85,438,139 R43Q probably benign Het
Snrnp200 G A 2: 127,216,175 A286T possibly damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Srebf2 T A 15: 82,194,954 H794Q probably benign Het
Ssbp2 T C 13: 91,664,184 probably benign Het
Sspo G A 6: 48,478,273 G3023D probably damaging Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Stab2 A G 10: 86,861,470 Y1985H probably benign Het
Suz12 A G 11: 79,999,100 M146V probably benign Het
Tac2 A G 10: 127,728,480 probably null Het
Thbd T C 2: 148,406,979 E323G probably damaging Het
Tnfrsf26 T A 7: 143,617,923 T98S probably damaging Het
Trim15 T C 17: 36,862,323 probably benign Het
Trpt1 T C 19: 6,998,193 V105A possibly damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r175 A G 7: 23,808,383 V273A probably benign Het
Vmn2r109 A G 17: 20,564,707 V17A probably benign Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Wdfy4 A T 14: 32,971,684 L2728Q probably damaging Het
Zfp934 T A 13: 62,518,294 T178S possibly damaging Het
Other mutations in Sept4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Sept4 APN 11 87589773 missense probably damaging 1.00
IGL00963:Sept4 APN 11 87583373 missense possibly damaging 0.89
IGL03087:Sept4 APN 11 87585245 splice site probably benign
IGL03268:Sept4 APN 11 87589703 missense probably damaging 0.99
R0077:Sept4 UTSW 11 87581196 missense probably benign
R1729:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1730:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1739:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1762:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1783:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1784:Sept4 UTSW 11 87583436 missense probably benign 0.26
R1785:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2131:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2133:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2140:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2141:Sept4 UTSW 11 87583436 missense probably benign 0.26
R2252:Sept4 UTSW 11 87589811 missense possibly damaging 0.75
R3696:Sept4 UTSW 11 87585234 missense possibly damaging 0.48
R4018:Sept4 UTSW 11 87585121 missense probably damaging 1.00
R4193:Sept4 UTSW 11 87583316 critical splice acceptor site probably null
R4196:Sept4 UTSW 11 87588772 missense probably damaging 0.96
R5012:Sept4 UTSW 11 87584404 missense possibly damaging 0.78
R5149:Sept4 UTSW 11 87589245 missense probably damaging 1.00
R5891:Sept4 UTSW 11 87588924 unclassified probably benign
R6090:Sept4 UTSW 11 87589517 missense possibly damaging 0.48
R6145:Sept4 UTSW 11 87585246 splice site probably null
R6257:Sept4 UTSW 11 87590349 missense probably benign 0.07
R6704:Sept4 UTSW 11 87589030 missense probably damaging 1.00
R7064:Sept4 UTSW 11 87590367 missense probably benign 0.02
R7090:Sept4 UTSW 11 87584438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCTTGGGAATAGAAGGACC -3'
(R):5'- GACACCTGAAGCCACATATAGG -3'

Sequencing Primer
(F):5'- CTGCCATTTCCATCATACATAAGGG -3'
(R):5'- AGGTTAGTTTATTTCCTCTGAGTCTC -3'
Posted On2014-08-01