Incidental Mutation 'R1957:Stab2'
ID217937
Institutional Source Beutler Lab
Gene Symbol Stab2
Ensembl Gene ENSMUSG00000035459
Gene Namestabilin 2
SynonymsSTAB-2, FEEL-2
MMRRC Submission 039971-MU
Accession Numbers

Genbank: NM_138673; MGI: 2178743

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1957 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86841198-87008025 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86861470 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1985 (Y1985H)
Ref Sequence ENSEMBL: ENSMUSP00000048309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035288]
Predicted Effect probably benign
Transcript: ENSMUST00000035288
AA Change: Y1985H

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048309
Gene: ENSMUSG00000035459
AA Change: Y1985H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF 119 156 1.85e0 SMART
EGF 167 201 2.43e1 SMART
EGF 206 244 1.43e-1 SMART
EGF 248 284 3.82e-2 SMART
EGF 333 370 2.02e-1 SMART
FAS1 414 515 1.06e-8 SMART
FAS1 561 662 3.54e-19 SMART
EGF 746 783 6.76e-3 SMART
EGF 836 873 1.31e0 SMART
EGF 877 917 2.99e-4 SMART
EGF 921 960 3.51e-1 SMART
EGF 964 1002 1.99e0 SMART
FAS1 1038 1138 1.73e-13 SMART
FAS1 1181 1276 1.83e-12 SMART
EGF 1354 1391 6.92e0 SMART
EGF 1401 1435 1.11e1 SMART
EGF 1442 1477 3.01e0 SMART
EGF 1481 1519 1.64e-1 SMART
EGF 1523 1561 1.14e0 SMART
EGF 1565 1603 5.62e0 SMART
FAS1 1638 1734 2.23e-25 SMART
FAS1 1785 1891 6.92e-22 SMART
EGF 1966 2006 1.95e1 SMART
EGF_like 1977 2017 2.46e-1 SMART
EGF 2016 2050 1.14e0 SMART
EGF 2058 2089 1.56e1 SMART
EGF 2093 2130 1.36e1 SMART
EGF 2134 2173 2.13e0 SMART
LINK 2204 2298 2.08e-29 SMART
FAS1 2363 2455 3.19e-12 SMART
transmembrane domain 2467 2489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159445
Predicted Effect probably benign
Transcript: ENSMUST00000161560
AA Change: Y534H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000125263
Gene: ENSMUSG00000035459
AA Change: Y534H

DomainStartEndE-ValueType
EGF 30 68 1.64e-1 SMART
EGF 72 110 1.14e0 SMART
EGF 114 152 5.62e0 SMART
FAS1 187 283 2.23e-25 SMART
FAS1 334 440 6.92e-22 SMART
EGF 515 555 1.95e1 SMART
EGF_like 526 566 2.46e-1 SMART
EGF 565 599 1.14e0 SMART
EGF 607 638 1.56e1 SMART
EGF 643 680 1.36e1 SMART
EGF 684 723 2.13e0 SMART
LINK 754 848 2.08e-29 SMART
Predicted Effect unknown
Transcript: ENSMUST00000219341
AA Change: Y533H
Meta Mutation Damage Score 0.1572 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 15 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to bind and endocytose ligands such as hyaluronan, low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein has been shown to cycle between the plasma membrane and lysosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit no gross abnormaities. Mice homozygous for one null allele display elevated serum hyaluronic acid levels and decreased metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C T 15: 102,338,633 probably benign Het
Abce1 A G 8: 79,685,949 I583T probably benign Het
Adcy1 A T 11: 7,161,945 T937S probably benign Het
Adgra2 A G 8: 27,111,168 I279V possibly damaging Het
Adgrl4 A T 3: 151,510,779 N533I possibly damaging Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Amelx A T X: 169,182,157 probably null Het
Anks1b A T 10: 90,049,930 T163S probably damaging Het
Apc A G 18: 34,317,335 E2394G probably damaging Het
Arhgef39 C T 4: 43,499,309 G56E probably damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Arsj A G 3: 126,439,021 N472S probably benign Het
Atg2b T C 12: 105,669,418 Y197C probably damaging Het
B3gat1 A T 9: 26,755,952 D160V possibly damaging Het
Bmp7 T C 2: 172,939,921 E50G probably damaging Het
Bms1 T C 6: 118,392,978 E869G probably damaging Het
Brd4 G A 17: 32,221,366 P332L possibly damaging Het
Btbd11 T C 10: 85,633,699 L828P probably damaging Het
C130074G19Rik T C 1: 184,882,898 T32A probably benign Het
C1rl A T 6: 124,509,062 Y464F probably damaging Het
Ccdc150 T A 1: 54,263,909 M193K probably benign Het
Ccdc7a A G 8: 128,980,135 S338P probably damaging Het
Cenpu T C 8: 46,572,837 probably benign Het
Cep170 A C 1: 176,769,447 V448G probably benign Het
Col27a1 G T 4: 63,277,794 A879S probably benign Het
Crtac1 C T 19: 42,287,944 S515N possibly damaging Het
Cstad G A 2: 30,608,281 V43M unknown Het
Daam1 T C 12: 71,982,755 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dsg3 A G 18: 20,522,105 N153S probably damaging Het
Dzip3 C A 16: 48,927,593 L1151F probably damaging Het
Eml5 A T 12: 98,859,961 H644Q probably damaging Het
Emsy A G 7: 98,647,820 L52P probably damaging Het
Eno1 T A 4: 150,246,775 probably null Het
Epha3 T A 16: 63,772,952 T258S probably benign Het
Ern1 T C 11: 106,426,897 T134A probably damaging Het
Fam151b G T 13: 92,477,902 T26K probably damaging Het
Fam151b T A 13: 92,477,903 T26S probably damaging Het
Fat1 T C 8: 45,040,682 V3955A probably damaging Het
Fbn1 T C 2: 125,367,654 N930S possibly damaging Het
Fgr A G 4: 132,998,362 M361V probably benign Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Fndc7 G A 3: 108,883,509 T67I probably damaging Het
Fxr2 A G 11: 69,643,940 T216A probably benign Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm42669 A T 5: 107,508,872 E355D possibly damaging Het
Gm438 G A 4: 144,777,819 T254I possibly damaging Het
Gm5174 A T 10: 86,656,753 noncoding transcript Het
Gm5431 A T 11: 48,888,397 L844* probably null Het
Gm6489 T C 1: 31,287,371 noncoding transcript Het
Gm9833 G T 3: 10,089,286 V372F probably benign Het
Gna11 A G 10: 81,530,844 V344A probably damaging Het
Gtpbp3 A G 8: 71,490,455 E170G probably damaging Het
H2afz A C 3: 137,865,514 probably benign Het
Heatr1 A G 13: 12,396,538 N87D probably damaging Het
Iars2 T C 1: 185,295,671 K687E possibly damaging Het
Ica1 T C 6: 8,749,736 D71G possibly damaging Het
Ifnlr1 T C 4: 135,686,570 L10P probably damaging Het
Il1r1 T A 1: 40,313,140 L490* probably null Het
Ip6k3 A T 17: 27,151,168 L92Q probably benign Het
Itgbl1 T A 14: 123,966,678 F394I probably damaging Het
Kat6b T C 14: 21,628,879 Y437H probably damaging Het
Kcnh5 G C 12: 74,897,584 Q964E probably benign Het
Krt27 A T 11: 99,346,483 probably null Het
Mki67 A T 7: 135,698,399 D1635E probably benign Het
Mmp23 G T 4: 155,652,052 H177Q possibly damaging Het
Mylk2 C A 2: 152,917,607 Q406K possibly damaging Het
Myo1g A G 11: 6,512,159 probably null Het
Myrf T C 19: 10,219,796 T261A probably benign Het
Nmt2 C T 2: 3,325,382 P486L possibly damaging Het
Oard1 T A 17: 48,415,276 L100* probably null Het
Oca2 T C 7: 56,321,498 I391T possibly damaging Het
Olfr181 T A 16: 58,926,167 M135L probably benign Het
Olfr488 A C 7: 108,255,196 L314* probably null Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr780 A T 10: 129,321,871 I83F possibly damaging Het
Olfr826 C A 10: 130,179,978 A301S possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Pabpc4 T A 4: 123,286,865 S127T probably damaging Het
Pcdhb1 A G 18: 37,265,707 D237G probably damaging Het
Pdcd6ip T C 9: 113,708,022 Y29C probably damaging Het
Phf3 C A 1: 30,831,520 R95L probably damaging Het
Pkd1l2 A T 8: 117,030,682 V1539D probably damaging Het
Plxna1 A T 6: 89,331,291 D1271E probably damaging Het
Ppp3r2 A G 4: 49,681,726 F75L probably damaging Het
Pth2r C A 1: 65,372,355 D350E probably damaging Het
Rabgap1 T C 2: 37,483,762 F262S possibly damaging Het
Rbbp6 T C 7: 122,990,288 S438P probably benign Het
Rexo1 G A 10: 80,543,366 R1038C probably damaging Het
Rnf10 A G 5: 115,260,322 probably benign Het
Scyl1 C A 19: 5,760,104 A565S probably benign Het
Sept4 A G 11: 87,590,367 T378A probably benign Het
Sh3yl1 A G 12: 30,942,788 probably null Het
Slc1a7 G T 4: 107,968,585 D14Y probably benign Het
Slc32a1 T C 2: 158,614,043 V206A probably damaging Het
Smyd5 G A 6: 85,438,139 R43Q probably benign Het
Snrnp200 G A 2: 127,216,175 A286T possibly damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Srebf2 T A 15: 82,194,954 H794Q probably benign Het
Ssbp2 T C 13: 91,664,184 probably benign Het
Sspo G A 6: 48,478,273 G3023D probably damaging Het
St6galnac5 T A 3: 152,846,483 Q149L probably benign Het
Suz12 A G 11: 79,999,100 M146V probably benign Het
Tac2 A G 10: 127,728,480 probably null Het
Thbd T C 2: 148,406,979 E323G probably damaging Het
Tnfrsf26 T A 7: 143,617,923 T98S probably damaging Het
Trim15 T C 17: 36,862,323 probably benign Het
Trpt1 T C 19: 6,998,193 V105A possibly damaging Het
Vcam1 T C 3: 116,125,957 Y226C probably damaging Het
Vmn1r175 A G 7: 23,808,383 V273A probably benign Het
Vmn2r109 A G 17: 20,564,707 V17A probably benign Het
Vmn2r84 G A 10: 130,390,808 A387V probably benign Het
Wdfy4 A T 14: 32,971,684 L2728Q probably damaging Het
Zfp934 T A 13: 62,518,294 T178S possibly damaging Het
Other mutations in Stab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Stab2 APN 10 86869206 unclassified probably null
IGL00809:Stab2 APN 10 86848174 splice site probably benign
IGL00911:Stab2 APN 10 86969753 missense probably damaging 1.00
IGL01347:Stab2 APN 10 86901703 splice site probably null
IGL01411:Stab2 APN 10 86980008 splice site probably benign
IGL01503:Stab2 APN 10 86940613 splice site probably benign
IGL01599:Stab2 APN 10 86922895 missense probably damaging 1.00
IGL01635:Stab2 APN 10 86981128 missense probably benign 0.04
IGL01640:Stab2 APN 10 86954171 missense probably benign 0.09
IGL01671:Stab2 APN 10 86969277 missense possibly damaging 0.80
IGL02023:Stab2 APN 10 86871831 missense possibly damaging 0.67
IGL02075:Stab2 APN 10 86967650 missense possibly damaging 0.71
IGL02174:Stab2 APN 10 86859742 unclassified probably null
IGL02600:Stab2 APN 10 86954259 missense probably damaging 1.00
IGL02666:Stab2 APN 10 86850902 missense possibly damaging 0.67
IGL02668:Stab2 APN 10 86846163 splice site probably benign
IGL02709:Stab2 APN 10 86846165 splice site probably benign
IGL02728:Stab2 APN 10 86856556 missense possibly damaging 0.95
IGL02803:Stab2 APN 10 86950269 splice site probably benign
IGL02938:Stab2 APN 10 86871921 missense possibly damaging 0.77
IGL03033:Stab2 APN 10 86996803 critical splice donor site probably null
IGL03238:Stab2 APN 10 86855121 missense probably damaging 1.00
IGL03402:Stab2 APN 10 86969301 missense probably benign 0.03
3-1:Stab2 UTSW 10 86869177 missense probably damaging 0.96
F6893:Stab2 UTSW 10 86855171 missense probably damaging 1.00
K7371:Stab2 UTSW 10 86943289 critical splice donor site probably null
PIT4142001:Stab2 UTSW 10 86867175 missense possibly damaging 0.94
PIT4362001:Stab2 UTSW 10 86861435 nonsense probably null
R0015:Stab2 UTSW 10 86843617 missense probably benign
R0254:Stab2 UTSW 10 86897960 missense probably benign
R0310:Stab2 UTSW 10 86967613 splice site probably benign
R0333:Stab2 UTSW 10 86841627 missense probably benign
R0391:Stab2 UTSW 10 86947144 missense probably benign 0.27
R0400:Stab2 UTSW 10 86872610 missense probably damaging 1.00
R0433:Stab2 UTSW 10 86843491 splice site probably benign
R0440:Stab2 UTSW 10 86949928 missense probably benign 0.23
R0743:Stab2 UTSW 10 86887895 missense probably damaging 1.00
R0847:Stab2 UTSW 10 86969871 missense probably benign 0.00
R0883:Stab2 UTSW 10 86924450 splice site probably benign
R1078:Stab2 UTSW 10 86907133 splice site probably null
R1118:Stab2 UTSW 10 86885718 unclassified probably null
R1119:Stab2 UTSW 10 86859755 missense possibly damaging 0.51
R1179:Stab2 UTSW 10 86950301 missense probably damaging 0.98
R1440:Stab2 UTSW 10 86861367 unclassified probably null
R1550:Stab2 UTSW 10 86878926 missense probably benign 0.01
R1616:Stab2 UTSW 10 86885718 unclassified probably null
R1728:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1768:Stab2 UTSW 10 87003008 missense probably damaging 1.00
R1772:Stab2 UTSW 10 86954234 missense probably benign 0.06
R1776:Stab2 UTSW 10 86957816 missense possibly damaging 0.92
R1784:Stab2 UTSW 10 86938039 missense probably benign 0.41
R1892:Stab2 UTSW 10 86938049 missense probably damaging 0.99
R1972:Stab2 UTSW 10 86960316 missense probably damaging 0.99
R1975:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1976:Stab2 UTSW 10 86896496 critical splice donor site probably null
R1996:Stab2 UTSW 10 87003031 missense probably damaging 1.00
R2085:Stab2 UTSW 10 86954159 missense probably damaging 1.00
R2149:Stab2 UTSW 10 86865040 nonsense probably null
R2169:Stab2 UTSW 10 86887862 missense probably damaging 1.00
R2201:Stab2 UTSW 10 86940639 missense probably benign 0.22
R2296:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2297:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2298:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2326:Stab2 UTSW 10 86954474 critical splice acceptor site probably null
R2434:Stab2 UTSW 10 86969319 missense possibly damaging 0.78
R2519:Stab2 UTSW 10 86934840 splice site probably benign
R2696:Stab2 UTSW 10 86861499 missense probably benign 0.45
R2883:Stab2 UTSW 10 86967686 missense possibly damaging 0.92
R2923:Stab2 UTSW 10 86861461 missense probably damaging 1.00
R3711:Stab2 UTSW 10 86866708 missense probably damaging 1.00
R3787:Stab2 UTSW 10 86969277 missense possibly damaging 0.50
R3834:Stab2 UTSW 10 86949912 missense possibly damaging 0.87
R3970:Stab2 UTSW 10 86878886 missense probably damaging 0.97
R3979:Stab2 UTSW 10 86863456 missense possibly damaging 0.56
R4003:Stab2 UTSW 10 86858124 missense probably damaging 1.00
R4088:Stab2 UTSW 10 86922185 missense probably damaging 1.00
R4151:Stab2 UTSW 10 87002983 missense probably benign 0.12
R4190:Stab2 UTSW 10 86878944 missense probably damaging 0.98
R4556:Stab2 UTSW 10 86967679 missense possibly damaging 0.95
R4773:Stab2 UTSW 10 86907371 nonsense probably null
R4825:Stab2 UTSW 10 86947147 missense probably benign 0.08
R4865:Stab2 UTSW 10 86843500 unclassified probably null
R4871:Stab2 UTSW 10 86942235 missense probably damaging 0.99
R4943:Stab2 UTSW 10 86954162 missense probably damaging 0.99
R4981:Stab2 UTSW 10 86960223 missense probably benign
R4994:Stab2 UTSW 10 86949907 missense probably benign
R4999:Stab2 UTSW 10 86937909 missense probably damaging 0.97
R5061:Stab2 UTSW 10 86907385 missense probably damaging 1.00
R5072:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5073:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5074:Stab2 UTSW 10 86863558 missense probably benign 0.23
R5134:Stab2 UTSW 10 86871810 unclassified probably null
R5213:Stab2 UTSW 10 86907197 missense probably damaging 0.99
R5508:Stab2 UTSW 10 86960279 missense probably benign 0.01
R5530:Stab2 UTSW 10 86947162 missense probably benign 0.04
R5540:Stab2 UTSW 10 86848125 missense probably benign 0.30
R5839:Stab2 UTSW 10 86872691 missense probably damaging 0.97
R5949:Stab2 UTSW 10 86969849 missense possibly damaging 0.87
R6015:Stab2 UTSW 10 86938042 missense probably damaging 0.99
R6019:Stab2 UTSW 10 87003022 missense probably benign 0.00
R6116:Stab2 UTSW 10 86907190 missense probably damaging 1.00
R6131:Stab2 UTSW 10 86883778 unclassified probably null
R6209:Stab2 UTSW 10 86923003 missense possibly damaging 0.94
R6243:Stab2 UTSW 10 86907161 missense probably damaging 1.00
R6433:Stab2 UTSW 10 86901567 splice site probably null
R6787:Stab2 UTSW 10 86919084 missense probably benign 0.07
R6841:Stab2 UTSW 10 86942190 missense probably damaging 1.00
R6873:Stab2 UTSW 10 86861366 critical splice donor site probably null
R7025:Stab2 UTSW 10 86850837 missense probably damaging 1.00
R7043:Stab2 UTSW 10 86870246 missense probably damaging 0.99
R7047:Stab2 UTSW 10 86858152 missense probably damaging 1.00
R7107:Stab2 UTSW 10 86905592 missense possibly damaging 0.96
R7214:Stab2 UTSW 10 86899841 missense probably damaging 0.99
R7291:Stab2 UTSW 10 86946220 missense probably damaging 0.96
X0023:Stab2 UTSW 10 86922198 critical splice acceptor site probably null
X0025:Stab2 UTSW 10 86887816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAAGTGGGTGGCAATGAC -3'
(R):5'- TCAGATCAGACACTTGATACTTGG -3'

Sequencing Primer
(F):5'- GCAATGACAAGGACAGATAACATAC -3'
(R):5'- TTACAGCAGTGCTGAGTG -3'
Posted On2014-08-01