Mutagenetix > Incidental Mutation

Incidental Mutation 'R0722:Igf2r'

218784

Institutional Source

Beutler Lab

Gene Symbol

Igf2r

Ensembl Gene

ENSMUSG00000023830

Gene Name

insulin-like growth factor 2 receptor

Synonyms

IGF-II/CI-MPR, CD222, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CI-MPR

MMRRC Submission

038904-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.905) question?

Stock #

R0722 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

12901293-12988551 bp(-) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 12934382 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000024599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024599]

AlphaFold

Q07113

Predicted Effect

probably null
Transcript: ENSMUST00000024599

SMART Domains

Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830

Domain	Start	End	E-Value	Type
signal peptide	1	35	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
Pfam:CIMR	118	266	5.1e-21	PFAM
Pfam:CIMR	272	416	8.8e-22	PFAM
Pfam:CIMR	418	567	3.4e-53	PFAM
Pfam:CIMR	569	709	6.5e-47	PFAM
Pfam:CIMR	713	869	6.5e-34	PFAM
Pfam:CIMR	876	1020	1.9e-10	PFAM
Pfam:CIMR	1024	1171	1e-60	PFAM
Pfam:CIMR	1172	1313	1.2e-17	PFAM
Pfam:CIMR	1315	1455	2.1e-58	PFAM
Pfam:CIMR	1458	1592	1.8e-22	PFAM
Pfam:CIMR	1596	1743	9.1e-23	PFAM
Pfam:CIMR	1748	1887	2.5e-22	PFAM
FN2	1889	1935	9.51e-26	SMART
Pfam:CIMR	1939	2076	2.1e-22	PFAM
Pfam:CIMR	2230	2294	4.9e-9	PFAM
transmembrane domain	2295	2317	N/A	INTRINSIC
low complexity region	2336	2363	N/A	INTRINSIC

Meta Mutation Damage Score

0.9590

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 91.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adap2	T	C	11: 80,047,810 (GRCm39)	F89L	possibly damaging	Het
Akr1c13	A	G	13: 4,247,931 (GRCm39)		probably null	Het
Atp10a	A	G	7: 58,465,931 (GRCm39)	I1053V	possibly damaging	Het
Bmper	G	T	9: 23,285,224 (GRCm39)	V258L	probably benign	Het
Brd4	T	C	17: 32,431,956 (GRCm39)	H636R	possibly damaging	Het
Cacna2d4	C	T	6: 119,284,247 (GRCm39)	R745W	probably damaging	Het
Ccbe1	C	T	18: 66,217,877 (GRCm39)	C112Y	probably damaging	Het
Ccdc28b	T	A	4: 129,514,945 (GRCm39)		probably null	Het
Cd320	T	C	17: 34,065,004 (GRCm39)	S46P	possibly damaging	Het
Cfap251	T	A	5: 123,394,248 (GRCm39)	V379E	probably damaging	Het
Cfap44	G	A	16: 44,225,039 (GRCm39)	E95K	possibly damaging	Het
Clpp	T	C	17: 57,299,901 (GRCm39)	V144A	probably damaging	Het
Crtam	A	T	9: 40,903,912 (GRCm39)	C96S	probably damaging	Het
Dcst1	C	T	3: 89,261,112 (GRCm39)	R480H	probably benign	Het
Dock2	A	T	11: 34,414,970 (GRCm39)		probably benign	Het
Ermard	A	G	17: 15,242,390 (GRCm39)	T189A	probably benign	Het
Gm10840	A	G	11: 106,051,902 (GRCm39)		probably benign	Het
Gm4845	T	A	1: 141,184,598 (GRCm39)		noncoding transcript	Het
Heatr1	A	G	13: 12,420,918 (GRCm39)	E403G	probably benign	Het
Herc4	A	G	10: 63,121,844 (GRCm39)	I399V	probably null	Het
Htr1f	A	G	16: 64,746,254 (GRCm39)	I346T	probably damaging	Het
Jmy	G	A	13: 93,589,325 (GRCm39)	T644I	probably benign	Het
Kcnn2	T	C	18: 45,692,543 (GRCm39)	C40R	possibly damaging	Het
Krt13	T	G	11: 100,009,979 (GRCm39)	K297T	probably damaging	Het
Lrba	T	C	3: 86,513,296 (GRCm39)		probably null	Het
Lrrc8b	T	C	5: 105,627,978 (GRCm39)	V108A	possibly damaging	Het
Lrrc8c	T	A	5: 105,727,414 (GRCm39)	V26E	probably damaging	Het
Or10g6	A	G	9: 39,934,295 (GRCm39)	D202G	probably damaging	Het
Or5p6	A	G	7: 107,631,541 (GRCm39)	F3S	probably benign	Het
Pcna	A	G	2: 132,093,155 (GRCm39)		probably benign	Het
Pgm2	A	T	5: 64,265,022 (GRCm39)	R348*	probably null	Het
Pikfyve	T	G	1: 65,292,682 (GRCm39)	S1378A	probably damaging	Het
Pkp2	T	C	16: 16,064,892 (GRCm39)	V472A	probably benign	Het
Pld5	A	G	1: 175,803,081 (GRCm39)	F395L	probably benign	Het
Plekhb1	A	T	7: 100,294,810 (GRCm39)	Y169N	probably damaging	Het
Polr2c	T	A	8: 95,589,265 (GRCm39)	Y186N	probably damaging	Het
Ppp1r16a	C	T	15: 76,577,869 (GRCm39)	Q328*	probably null	Het
Prr5l	A	G	2: 101,547,819 (GRCm39)		probably benign	Het
Ptbp2	C	T	3: 119,514,570 (GRCm39)	R419Q	possibly damaging	Het
Ralgapa2	A	G	2: 146,230,451 (GRCm39)	V1038A	probably damaging	Het
Rassf2	A	G	2: 131,844,830 (GRCm39)	V204A	probably damaging	Het
Slc22a22	T	C	15: 57,119,949 (GRCm39)		probably null	Het
Slit1	T	C	19: 41,596,874 (GRCm39)	Y1075C	probably damaging	Het
Smc5	C	A	19: 23,186,291 (GRCm39)	L1055F	probably damaging	Het
Spidr	A	G	16: 15,730,645 (GRCm39)	F620S	probably damaging	Het
Susd1	A	G	4: 59,379,749 (GRCm39)	S293P	possibly damaging	Het
Tepsin	A	G	11: 119,986,163 (GRCm39)		probably benign	Het
Vmn2r68	A	T	7: 84,870,794 (GRCm39)	L830I	possibly damaging	Het
Vtn	A	G	11: 78,391,680 (GRCm39)		probably benign	Het
Zfp267	C	T	3: 36,219,218 (GRCm39)	H414Y	probably benign	Het
Zfp280d	T	G	9: 72,219,383 (GRCm39)	S162A	possibly damaging	Het
Zfp608	T	G	18: 55,033,306 (GRCm39)	K409T	probably damaging	Het
Zfp738	A	T	13: 67,819,643 (GRCm39)	M116K	probably benign	Het

Other mutations in Igf2r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Igf2r	APN	17	12,932,877 (GRCm39)	missense	probably benign	0.01
IGL00534:Igf2r	APN	17	12,958,215 (GRCm39)	missense	probably damaging	0.97
IGL00902:Igf2r	APN	17	12,919,245 (GRCm39)	missense	probably damaging	0.99
IGL00903:Igf2r	APN	17	12,902,754 (GRCm39)	missense	possibly damaging	0.70
IGL01160:Igf2r	APN	17	12,923,662 (GRCm39)	missense	possibly damaging	0.73
IGL01380:Igf2r	APN	17	12,914,261 (GRCm39)	missense	probably benign	0.01
IGL01392:Igf2r	APN	17	12,923,236 (GRCm39)	missense	probably benign
IGL01557:Igf2r	APN	17	12,923,522 (GRCm39)	missense	possibly damaging	0.82
IGL01568:Igf2r	APN	17	12,902,872 (GRCm39)	missense	possibly damaging	0.93
IGL01611:Igf2r	APN	17	12,944,302 (GRCm39)	nonsense	probably null
IGL01720:Igf2r	APN	17	12,920,200 (GRCm39)	missense	probably damaging	0.99
IGL01756:Igf2r	APN	17	12,902,709 (GRCm39)	missense	probably benign
IGL01839:Igf2r	APN	17	12,923,909 (GRCm39)	missense	probably damaging	1.00
IGL01904:Igf2r	APN	17	12,933,798 (GRCm39)	missense	probably damaging	0.99
IGL01965:Igf2r	APN	17	12,923,225 (GRCm39)	missense	probably benign	0.12
IGL02083:Igf2r	APN	17	12,912,079 (GRCm39)	nonsense	probably null
IGL02095:Igf2r	APN	17	12,920,892 (GRCm39)	missense	probably damaging	0.99
IGL02183:Igf2r	APN	17	12,917,403 (GRCm39)	unclassified	probably benign
IGL02576:Igf2r	APN	17	12,967,650 (GRCm39)	missense	possibly damaging	0.90
IGL02649:Igf2r	APN	17	12,930,974 (GRCm39)	missense	possibly damaging	0.93
IGL02807:Igf2r	APN	17	12,938,770 (GRCm39)	missense	probably damaging	0.98
IGL02833:Igf2r	APN	17	12,911,610 (GRCm39)	missense	probably damaging	0.97
IGL02885:Igf2r	APN	17	12,913,007 (GRCm39)	missense	possibly damaging	0.94
IGL02990:Igf2r	APN	17	12,929,633 (GRCm39)	splice site	probably benign
IGL03080:Igf2r	APN	17	12,945,563 (GRCm39)	missense	probably benign	0.06
IGL03176:Igf2r	APN	17	12,935,559 (GRCm39)	missense	probably damaging	1.00
blunt	UTSW	17	12,941,062 (GRCm39)	missense	probably benign	0.02
brusque	UTSW	17	12,933,838 (GRCm39)	missense	probably damaging	0.98
gruff	UTSW	17	12,902,984 (GRCm39)	missense	probably damaging	0.96
outlier	UTSW	17	12,914,201 (GRCm39)	missense	probably benign	0.20
NA:Igf2r	UTSW	17	12,910,849 (GRCm39)	missense	probably benign
R0165:Igf2r	UTSW	17	12,917,414 (GRCm39)	missense	probably benign	0.07
R0412:Igf2r	UTSW	17	12,902,835 (GRCm39)	missense	probably damaging	0.98
R0523:Igf2r	UTSW	17	12,910,951 (GRCm39)	missense	probably benign	0.27
R0631:Igf2r	UTSW	17	12,936,161 (GRCm39)	splice site	probably null
R0894:Igf2r	UTSW	17	12,910,988 (GRCm39)	missense	probably benign	0.02
R1265:Igf2r	UTSW	17	12,913,011 (GRCm39)	missense	probably damaging	0.98
R1466:Igf2r	UTSW	17	12,936,156 (GRCm39)	splice site	probably benign
R1485:Igf2r	UTSW	17	12,910,172 (GRCm39)	missense	probably damaging	1.00
R1633:Igf2r	UTSW	17	12,945,196 (GRCm39)	missense	probably benign
R1693:Igf2r	UTSW	17	12,923,203 (GRCm39)	missense	probably damaging	0.97
R1751:Igf2r	UTSW	17	12,916,328 (GRCm39)	missense	possibly damaging	0.94
R1843:Igf2r	UTSW	17	12,923,157 (GRCm39)	critical splice donor site	probably null
R1981:Igf2r	UTSW	17	12,952,790 (GRCm39)	nonsense	probably null
R1994:Igf2r	UTSW	17	12,911,625 (GRCm39)	missense	probably benign
R2060:Igf2r	UTSW	17	12,920,206 (GRCm39)	missense	possibly damaging	0.92
R2108:Igf2r	UTSW	17	12,917,138 (GRCm39)	missense	probably benign	0.02
R2132:Igf2r	UTSW	17	12,941,095 (GRCm39)	missense	probably benign	0.12
R2314:Igf2r	UTSW	17	12,934,830 (GRCm39)	missense	probably benign	0.28
R2349:Igf2r	UTSW	17	12,941,198 (GRCm39)	splice site	probably null
R2696:Igf2r	UTSW	17	12,914,231 (GRCm39)	missense	possibly damaging	0.96
R2864:Igf2r	UTSW	17	12,905,611 (GRCm39)	missense	probably damaging	0.99
R2865:Igf2r	UTSW	17	12,905,611 (GRCm39)	missense	probably damaging	0.99
R3884:Igf2r	UTSW	17	12,928,355 (GRCm39)	missense	probably benign
R3930:Igf2r	UTSW	17	12,924,716 (GRCm39)	missense	probably benign	0.01
R4021:Igf2r	UTSW	17	12,967,638 (GRCm39)	missense	probably damaging	0.97
R4125:Igf2r	UTSW	17	12,921,141 (GRCm39)	missense	possibly damaging	0.93
R4342:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4343:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4345:Igf2r	UTSW	17	12,928,398 (GRCm39)	missense	possibly damaging	0.95
R4760:Igf2r	UTSW	17	12,922,352 (GRCm39)	missense	possibly damaging	0.92
R4796:Igf2r	UTSW	17	12,903,013 (GRCm39)	missense	possibly damaging	0.70
R4816:Igf2r	UTSW	17	12,902,984 (GRCm39)	missense	probably damaging	0.96
R4826:Igf2r	UTSW	17	12,920,240 (GRCm39)	missense	probably damaging	0.98
R4933:Igf2r	UTSW	17	12,910,764 (GRCm39)	splice site	probably null
R4980:Igf2r	UTSW	17	12,922,247 (GRCm39)	critical splice donor site	probably null
R5389:Igf2r	UTSW	17	12,944,303 (GRCm39)	missense	probably damaging	1.00
R5473:Igf2r	UTSW	17	12,914,201 (GRCm39)	missense	probably benign	0.20
R5494:Igf2r	UTSW	17	12,912,032 (GRCm39)	missense	possibly damaging	0.74
R5619:Igf2r	UTSW	17	12,958,221 (GRCm39)	missense	probably damaging	1.00
R5738:Igf2r	UTSW	17	12,936,254 (GRCm39)	missense	probably benign	0.23
R5761:Igf2r	UTSW	17	12,917,239 (GRCm39)	splice site	probably null
R5794:Igf2r	UTSW	17	12,928,332 (GRCm39)	missense	probably benign	0.37
R6210:Igf2r	UTSW	17	12,933,838 (GRCm39)	missense	probably damaging	0.98
R6319:Igf2r	UTSW	17	12,933,000 (GRCm39)	missense	probably damaging	1.00
R6388:Igf2r	UTSW	17	12,902,787 (GRCm39)	missense	probably benign
R6396:Igf2r	UTSW	17	12,932,977 (GRCm39)	missense	probably benign	0.00
R6584:Igf2r	UTSW	17	12,920,137 (GRCm39)	missense	probably damaging	0.99
R6590:Igf2r	UTSW	17	12,910,824 (GRCm39)	nonsense	probably null
R6591:Igf2r	UTSW	17	12,907,895 (GRCm39)	missense	probably damaging	1.00
R6599:Igf2r	UTSW	17	12,917,505 (GRCm39)	missense	possibly damaging	0.85
R6690:Igf2r	UTSW	17	12,910,824 (GRCm39)	nonsense	probably null
R6691:Igf2r	UTSW	17	12,907,895 (GRCm39)	missense	probably damaging	1.00
R6752:Igf2r	UTSW	17	12,933,831 (GRCm39)	missense	probably damaging	1.00
R6816:Igf2r	UTSW	17	12,932,969 (GRCm39)	missense	probably damaging	0.99
R6841:Igf2r	UTSW	17	12,922,263 (GRCm39)	missense	probably damaging	0.97
R6877:Igf2r	UTSW	17	12,916,228 (GRCm39)	missense	probably damaging	0.97
R6950:Igf2r	UTSW	17	12,937,605 (GRCm39)	missense	probably benign
R7030:Igf2r	UTSW	17	12,952,753 (GRCm39)	missense	probably damaging	1.00
R7038:Igf2r	UTSW	17	12,917,212 (GRCm39)	missense	probably benign	0.23
R7055:Igf2r	UTSW	17	12,923,210 (GRCm39)	missense	probably damaging	0.99
R7074:Igf2r	UTSW	17	12,933,003 (GRCm39)	missense	possibly damaging	0.57
R7348:Igf2r	UTSW	17	12,922,371 (GRCm39)	missense	probably damaging	0.99
R7413:Igf2r	UTSW	17	12,917,115 (GRCm39)	nonsense	probably null
R7463:Igf2r	UTSW	17	12,929,532 (GRCm39)	missense	probably benign	0.16
R7619:Igf2r	UTSW	17	12,917,160 (GRCm39)	missense	possibly damaging	0.88
R7730:Igf2r	UTSW	17	12,954,878 (GRCm39)	missense	probably damaging	0.98
R7733:Igf2r	UTSW	17	12,958,256 (GRCm39)	missense	possibly damaging	0.90
R7881:Igf2r	UTSW	17	12,967,591 (GRCm39)	missense	probably benign
R8022:Igf2r	UTSW	17	12,937,682 (GRCm39)	missense	probably damaging	1.00
R8138:Igf2r	UTSW	17	12,920,125 (GRCm39)	missense	probably benign	0.32
R8220:Igf2r	UTSW	17	12,910,958 (GRCm39)	missense	probably benign	0.22
R8305:Igf2r	UTSW	17	12,952,747 (GRCm39)	missense	probably benign
R8359:Igf2r	UTSW	17	12,902,748 (GRCm39)	missense	probably benign
R8500:Igf2r	UTSW	17	12,928,328 (GRCm39)	missense	probably damaging	0.99
R8510:Igf2r	UTSW	17	12,923,200 (GRCm39)	missense	probably benign	0.38
R8933:Igf2r	UTSW	17	12,923,524 (GRCm39)	missense	probably damaging	1.00
R8933:Igf2r	UTSW	17	12,920,131 (GRCm39)	missense	probably damaging	0.97
R8976:Igf2r	UTSW	17	12,945,659 (GRCm39)	missense	probably damaging	1.00
R8994:Igf2r	UTSW	17	12,935,537 (GRCm39)	missense	possibly damaging	0.87
R9059:Igf2r	UTSW	17	12,970,180 (GRCm39)	start codon destroyed	probably null
R9097:Igf2r	UTSW	17	12,910,100 (GRCm39)	missense	probably damaging	1.00
R9127:Igf2r	UTSW	17	12,958,238 (GRCm39)	missense	probably damaging	0.98
R9278:Igf2r	UTSW	17	12,914,240 (GRCm39)	missense	probably damaging	1.00
R9362:Igf2r	UTSW	17	12,941,062 (GRCm39)	missense	probably benign	0.02
R9371:Igf2r	UTSW	17	12,924,646 (GRCm39)	missense	possibly damaging	0.93
R9522:Igf2r	UTSW	17	12,917,215 (GRCm39)	missense	probably benign	0.26
R9567:Igf2r	UTSW	17	12,905,641 (GRCm39)	missense	probably damaging	1.00
R9665:Igf2r	UTSW	17	12,913,027 (GRCm39)	missense	probably benign	0.17
R9666:Igf2r	UTSW	17	12,945,588 (GRCm39)	missense	probably benign
X0028:Igf2r	UTSW	17	12,923,800 (GRCm39)	nonsense	probably null
Z1177:Igf2r	UTSW	17	12,916,286 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GACAGTCTGAAGCTCCACATGCAG -3'
(R):5'- ATGCAGAAGCGATTTCCCTTCCCC -3'

Sequencing Primer
(F):5'- TTGATACCACAGACTGGTGAG -3'
(R):5'- CCAGGCCAGGCTCCATC -3'

Posted On

2014-08-20