Incidental Mutation 'R1966:2410002F23Rik'
ID218950
Institutional Source Beutler Lab
Gene Symbol 2410002F23Rik
Ensembl Gene ENSMUSG00000045411
Gene NameRIKEN cDNA 2410002F23 gene
Synonyms
MMRRC Submission 039979-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1966 (G1)
Quality Score224
Status Not validated
Chromosome7
Chromosomal Location44246722-44252319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44251226 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 185 (V185E)
Ref Sequence ENSEMBL: ENSMUSP00000140200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012921] [ENSMUST00000055858] [ENSMUST00000071296] [ENSMUST00000084937] [ENSMUST00000107945] [ENSMUST00000107948] [ENSMUST00000107949] [ENSMUST00000107950] [ENSMUST00000118216] [ENSMUST00000137702] [ENSMUST00000145653] [ENSMUST00000146155] [ENSMUST00000185481] [ENSMUST00000186606] [ENSMUST00000187524] [ENSMUST00000188111] [ENSMUST00000188382] [ENSMUST00000191537]
Predicted Effect probably benign
Transcript: ENSMUST00000012921
SMART Domains Protein: ENSMUSP00000012921
Gene: ENSMUSG00000012777

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 338 3.2e-53 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055858
AA Change: V185E

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103583
Gene: ENSMUSG00000045411
AA Change: V185E

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071296
AA Change: V185E

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071265
Gene: ENSMUSG00000045411
AA Change: V185E

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084937
AA Change: V185E

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095894
Gene: ENSMUSG00000045411
AA Change: V185E

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107945
SMART Domains Protein: ENSMUSP00000103578
Gene: ENSMUSG00000012777

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 324 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107948
AA Change: V185E

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103581
Gene: ENSMUSG00000045411
AA Change: V185E

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107949
AA Change: V185E

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103582
Gene: ENSMUSG00000045411
AA Change: V185E

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107950
AA Change: V185E

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103584
Gene: ENSMUSG00000045411
AA Change: V185E

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117033
Predicted Effect probably benign
Transcript: ENSMUST00000118216
SMART Domains Protein: ENSMUSP00000112922
Gene: ENSMUSG00000012777

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:His_Phos_2 30 338 3.2e-53 PFAM
transmembrane domain 392 414 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136210
Predicted Effect probably benign
Transcript: ENSMUST00000137702
SMART Domains Protein: ENSMUSP00000119445
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144905
Predicted Effect probably benign
Transcript: ENSMUST00000145653
Predicted Effect probably benign
Transcript: ENSMUST00000146155
SMART Domains Protein: ENSMUSP00000117318
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185481
SMART Domains Protein: ENSMUSP00000139913
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186606
AA Change: V68E

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139441
Gene: ENSMUSG00000045411
AA Change: V68E

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187524
SMART Domains Protein: ENSMUSP00000140017
Gene: ENSMUSG00000045411

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187581
Predicted Effect probably benign
Transcript: ENSMUST00000188111
AA Change: V185E

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139694
Gene: ENSMUSG00000045411
AA Change: V185E

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188382
AA Change: V185E

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140200
Gene: ENSMUSG00000045411
AA Change: V185E

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
low complexity region 167 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188476
Predicted Effect probably benign
Transcript: ENSMUST00000191537
AA Change: V68E

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141077
Gene: ENSMUSG00000045411
AA Change: V68E

DomainStartEndE-ValueType
low complexity region 50 60 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik A G 16: 8,830,581 E41G possibly damaging Het
Abca1 A C 4: 53,050,409 V1608G probably damaging Het
Ap2b1 T C 11: 83,346,895 I557T probably benign Het
Arhgef15 G T 11: 68,954,675 P117Q probably damaging Het
Arhgef39 T C 4: 43,496,710 S335G probably benign Het
Blm A T 7: 80,513,186 F139Y possibly damaging Het
Cacna2d1 C T 5: 16,333,785 R581* probably null Het
Cadps C A 14: 12,822,450 E97* probably null Het
Cavin2 T A 1: 51,289,642 L86Q probably damaging Het
Ccdc136 A G 6: 29,418,092 E787G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cdh23 T C 10: 60,323,582 Y2138C probably damaging Het
Cdk12 T A 11: 98,204,090 Y241* probably null Het
Clcn4 T A 7: 7,284,185 *688L probably null Het
Cntnap1 T C 11: 101,180,386 V375A possibly damaging Het
Coq5 T A 5: 115,294,831 probably null Het
Cyp4b1 A G 4: 115,625,879 I405T probably benign Het
Det1 T C 7: 78,843,218 Y346C probably damaging Het
Enpp3 A T 10: 24,807,491 V276E probably damaging Het
Epb41l2 G A 10: 25,441,768 R61Q probably benign Het
Fam76b G A 9: 13,828,066 probably null Het
Fbxo45 A T 16: 32,233,230 D238E probably benign Het
Fnip2 G A 3: 79,493,472 T314I probably benign Het
Fsip2 T C 2: 82,992,780 S6286P possibly damaging Het
Gbf1 T C 19: 46,271,564 F999L probably damaging Het
Gm14139 T A 2: 150,191,907 D49E probably benign Het
Gnao1 C A 8: 93,944,199 T102K probably benign Het
Gpatch2 T A 1: 187,322,301 D76E probably damaging Het
Gpd1l A G 9: 114,914,394 I146T probably benign Het
Grik2 A T 10: 49,355,909 H508Q probably damaging Het
Hk3 A T 13: 55,014,455 F112Y probably damaging Het
Hmcn2 T G 2: 31,389,329 I1781S probably damaging Het
Inhba A T 13: 16,026,636 K261M probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Kcna2 T C 3: 107,104,630 S176P probably damaging Het
Kcnj3 A T 2: 55,437,331 Q44L probably damaging Het
Kcns1 G T 2: 164,168,535 F101L probably damaging Het
Kdm5b T A 1: 134,613,873 probably null Het
Klhl14 C T 18: 21,554,673 G564D probably damaging Het
Klhl18 A T 9: 110,476,590 V2E probably benign Het
Klhl6 T C 16: 19,982,822 E61G probably damaging Het
Krt1 T C 15: 101,848,992 D261G probably benign Het
Lama5 C A 2: 180,188,352 C1896F probably damaging Het
Lrba A G 3: 86,605,868 probably null Het
Lrch3 A G 16: 32,914,385 T82A possibly damaging Het
Maml3 C G 3: 52,104,139 G2A unknown Het
Mapkap1 T A 2: 34,518,679 N34K probably damaging Het
Muc13 A T 16: 33,814,539 I488F probably damaging Het
Muc5ac A G 7: 141,803,376 D1129G possibly damaging Het
Nacc1 A T 8: 84,676,381 N288K probably damaging Het
Nek1 T G 8: 61,016,296 I129R probably damaging Het
Nf1 T A 11: 79,411,564 S319R possibly damaging Het
Nle1 C T 11: 82,901,788 G432D probably damaging Het
Nol4l A G 2: 153,529,455 V103A probably benign Het
Oca2 A G 7: 56,414,467 I737V probably damaging Het
Olfr1270 T C 2: 90,149,404 S201G probably damaging Het
Olfr231 G T 1: 174,117,251 S255* probably null Het
Olfr346 G A 2: 36,688,784 V261I probably benign Het
Olfr358 A T 2: 37,004,948 F222Y possibly damaging Het
Olfr630 G T 7: 103,755,168 T139K probably damaging Het
Olfr655 A G 7: 104,596,801 C127R probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Orc1 T A 4: 108,612,217 I746N probably damaging Het
Pbxip1 A G 3: 89,445,488 D147G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plin5 T A 17: 56,112,186 D412V probably damaging Het
Plxna2 A T 1: 194,644,700 Y314F possibly damaging Het
Ppid A T 3: 79,602,299 K308* probably null Het
Prss38 T C 11: 59,373,484 Y219C probably damaging Het
Ptx3 C T 3: 66,224,621 R188C probably damaging Het
Ralgds T A 2: 28,545,875 V504E probably damaging Het
Rere T C 4: 150,616,873 Y1237H probably damaging Het
Rpp30 C T 19: 36,089,149 S94L probably damaging Het
Rrp15 C T 1: 186,736,205 V205I possibly damaging Het
Scpep1 A G 11: 88,952,414 W73R probably damaging Het
Sec23ip A G 7: 128,755,353 H376R probably damaging Het
Serping1 G T 2: 84,765,728 T454K probably damaging Het
Shtn1 T G 19: 58,975,038 Y615S probably benign Het
Slc20a2 C A 8: 22,545,537 P184T probably damaging Het
Slc22a29 C A 19: 8,218,408 R89L probably damaging Het
Slc2a2 A G 3: 28,719,485 Q313R probably damaging Het
Tas2r122 A T 6: 132,711,194 Y245* probably null Het
Ticrr C A 7: 79,694,735 C1449* probably null Het
Tmem181a T C 17: 6,303,226 V412A probably benign Het
Tmtc4 T A 14: 122,927,599 E616V probably benign Het
Tnrc6b A G 15: 80,880,439 K714R probably damaging Het
Trpm8 T A 1: 88,332,748 probably null Het
Ubr2 T C 17: 46,954,919 T1163A probably benign Het
Ubr4 A G 4: 139,451,244 probably null Het
Ulk2 A T 11: 61,819,471 probably null Het
Ulk4 T A 9: 121,257,116 M350L probably benign Het
Vmn1r185 T C 7: 26,611,531 E183G probably benign Het
Vmn1r76 T A 7: 11,930,514 I223F probably damaging Het
Wdr27 T C 17: 14,934,599 T19A possibly damaging Het
Wdr59 T G 8: 111,450,903 T973P possibly damaging Het
Wnk2 A G 13: 49,039,011 S664P probably damaging Het
Zfp120 A T 2: 150,117,398 C335S probably damaging Het
Zfp30 C A 7: 29,792,452 Q44K probably benign Het
Zfp541 T C 7: 16,079,071 S550P probably benign Het
Zw10 C A 9: 49,068,833 N421K probably damaging Het
Other mutations in 2410002F23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03249:2410002F23Rik APN 7 44250725 missense probably damaging 1.00
R1137:2410002F23Rik UTSW 7 44250832 missense probably benign 0.00
R1930:2410002F23Rik UTSW 7 44251116 missense probably damaging 0.99
R2109:2410002F23Rik UTSW 7 44251011 missense probably benign 0.20
R5580:2410002F23Rik UTSW 7 44251240 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGGCATGATTGAGTGGATCTACC -3'
(R):5'- CTCGTTCAGCCCATAGTTGG -3'

Sequencing Primer
(F):5'- ATTGAGTGGATCTACCTTGACCCAG -3'
(R):5'- CTTTGATGTAGAGTTCTAGGAGTACC -3'
Posted On2014-08-25