Incidental Mutation 'R2035:Sdccag3'
ID224421
Institutional Source Beutler Lab
Gene Symbol Sdccag3
Ensembl Gene ENSMUSG00000026927
Gene Nameserologically defined colon cancer antigen 3
Synonyms
MMRRC Submission 040042-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2035 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26382802-26389316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26383627 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 374 (S374C)
Ref Sequence ENSEMBL: ENSMUSP00000028293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028293] [ENSMUST00000035427] [ENSMUST00000077983] [ENSMUST00000114100] [ENSMUST00000114102] [ENSMUST00000114115] [ENSMUST00000139738]
Predicted Effect probably damaging
Transcript: ENSMUST00000028293
AA Change: S374C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028293
Gene: ENSMUSG00000026927
AA Change: S374C

DomainStartEndE-ValueType
coiled coil region 209 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035427
SMART Domains Protein: ENSMUSP00000041767
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
coiled coil region 93 119 N/A INTRINSIC
low complexity region 200 212 N/A INTRINSIC
SANT 219 290 2.37e1 SMART
SANT 293 343 4.38e-10 SMART
SANT 345 397 3.05e-9 SMART
SANT 400 449 8.24e-15 SMART
SANT 452 501 7.8e-16 SMART
low complexity region 516 547 N/A INTRINSIC
Blast:SANT 550 753 1e-23 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 925 947 N/A INTRINSIC
low complexity region 971 983 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1157 1169 N/A INTRINSIC
low complexity region 1176 1190 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077983
AA Change: S351C

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077133
Gene: ENSMUSG00000026927
AA Change: S351C

DomainStartEndE-ValueType
coiled coil region 186 298 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114100
AA Change: S401C

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109735
Gene: ENSMUSG00000026927
AA Change: S401C

DomainStartEndE-ValueType
coiled coil region 236 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114102
AA Change: S424C

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109737
Gene: ENSMUSG00000026927
AA Change: S424C

DomainStartEndE-ValueType
coiled coil region 259 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114115
SMART Domains Protein: ENSMUSP00000109750
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
coiled coil region 3 29 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 101 127 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
SANT 227 298 2.37e1 SMART
SANT 301 351 4.38e-10 SMART
SANT 353 405 3.05e-9 SMART
SANT 408 457 8.24e-15 SMART
SANT 460 509 7.8e-16 SMART
low complexity region 524 555 N/A INTRINSIC
Blast:SANT 558 761 1e-23 BLAST
low complexity region 901 917 N/A INTRINSIC
low complexity region 933 955 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 996 1015 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1184 1198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137814
Predicted Effect probably benign
Transcript: ENSMUST00000139738
SMART Domains Protein: ENSMUSP00000121256
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155643
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,612,642 *1273Q probably null Het
2810474O19Rik G A 6: 149,329,226 V1257I possibly damaging Het
Aars2 A G 17: 45,514,801 I348V possibly damaging Het
Abca8b G A 11: 109,957,106 R788C possibly damaging Het
Abhd15 T C 11: 77,515,710 L171P probably damaging Het
Abi3bp A T 16: 56,660,218 H686L probably benign Het
Acsl1 A G 8: 46,528,584 Y456C probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ash1l T A 3: 89,066,317 V2561D probably benign Het
B3galnt2 T A 13: 13,966,324 F44I probably benign Het
Bicra A T 7: 15,996,413 H24Q possibly damaging Het
Ccdc163 T C 4: 116,711,333 S195P probably damaging Het
Cd163 A T 6: 124,320,629 K911N probably damaging Het
Clcn3 A T 8: 60,934,598 S179T probably damaging Het
Dctn4 T A 18: 60,538,417 D120E possibly damaging Het
Dgcr14 A G 16: 17,910,086 probably null Het
Dnali1 C T 4: 125,059,110 V207M probably damaging Het
Dnhd1 A G 7: 105,704,921 Q3036R probably damaging Het
Dst G A 1: 34,271,413 R4098H probably damaging Het
Eml5 A T 12: 98,794,266 N1741K probably benign Het
Enah G A 1: 181,921,972 P415L probably damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Gm4841 T G 18: 60,269,857 Y388S probably benign Het
Grin3a T C 4: 49,771,336 T479A probably damaging Het
Gucy2e C A 11: 69,227,532 V743L probably benign Het
Il33 T A 19: 29,954,637 N143K probably damaging Het
Ism1 T A 2: 139,757,155 S349R probably damaging Het
Itgb2 T A 10: 77,547,199 D134E probably damaging Het
Kcnk1 A C 8: 126,025,369 N238T possibly damaging Het
Kcnu1 G T 8: 25,896,693 V535L probably benign Het
Muc19 T A 15: 91,892,405 noncoding transcript Het
Mycbp2 A T 14: 103,260,239 Y966N probably damaging Het
Myo19 A T 11: 84,897,608 M349L probably benign Het
Narf G A 11: 121,238,500 A37T probably benign Het
Ncapd2 T C 6: 125,184,528 N208D probably benign Het
Nr1i2 A G 16: 38,251,126 probably null Het
Olfr1354 T C 10: 78,917,587 V249A possibly damaging Het
Olfr596 T A 7: 103,310,256 H178Q probably damaging Het
Opn5 A G 17: 42,607,161 I70T probably damaging Het
Pkn2 G T 3: 142,820,587 P410T probably damaging Het
Pla2r1 T C 2: 60,422,736 N1337S probably damaging Het
Prkd3 A T 17: 78,975,373 probably null Het
Pum2 T A 12: 8,728,638 Y429* probably null Het
Rttn T A 18: 89,020,216 V812E probably damaging Het
Rufy2 T A 10: 63,006,747 L483H probably damaging Het
Slc35a3 T A 3: 116,687,323 Q97L probably damaging Het
St18 A T 1: 6,802,328 M96L probably benign Het
Strc G A 2: 121,374,934 A905V probably damaging Het
Syne3 T C 12: 104,958,127 M338V probably benign Het
Syngr2 A G 11: 117,813,360 D187G probably benign Het
Tas2r109 A C 6: 132,980,460 I169R probably benign Het
Tbc1d22a T A 15: 86,391,065 probably null Het
Thbs1 T A 2: 118,118,340 probably null Het
Them6 C A 15: 74,721,675 D127E probably damaging Het
Tmem132d T C 5: 127,792,458 D604G probably damaging Het
Tnni1 A G 1: 135,805,592 T51A probably benign Het
Topors T C 4: 40,262,879 N135S probably damaging Het
Unc80 A T 1: 66,606,593 D1476V probably damaging Het
Vmn1r17 A G 6: 57,360,588 V264A probably benign Het
Vmn1r193 T A 13: 22,219,562 T87S probably benign Het
Vmn1r202 C A 13: 22,501,602 R215L probably damaging Het
Vmn2r24 A T 6: 123,816,060 N782I probably damaging Het
Vmn2r53 A G 7: 12,598,511 F404L possibly damaging Het
Xpo4 A T 14: 57,585,926 C1036S possibly damaging Het
Yae1d1 T C 13: 17,989,721 N104D probably benign Het
Zan C A 5: 137,443,947 R1901L unknown Het
Zbtb9 G A 17: 26,974,923 R434H probably damaging Het
Zdhhc23 A C 16: 43,973,508 C268G probably damaging Het
Other mutations in Sdccag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02480:Sdccag3 APN 2 26385120 missense probably damaging 0.98
IGL03293:Sdccag3 APN 2 26387676 splice site probably benign
R0385:Sdccag3 UTSW 2 26387659 missense possibly damaging 0.82
R1707:Sdccag3 UTSW 2 26387606 missense probably damaging 1.00
R3743:Sdccag3 UTSW 2 26388643 intron probably benign
R3977:Sdccag3 UTSW 2 26384793 missense probably damaging 1.00
R4592:Sdccag3 UTSW 2 26388897 unclassified probably benign
R5389:Sdccag3 UTSW 2 26385547 missense probably damaging 1.00
R6030:Sdccag3 UTSW 2 26386971 missense possibly damaging 0.71
R6030:Sdccag3 UTSW 2 26386971 missense possibly damaging 0.71
R6381:Sdccag3 UTSW 2 26385081 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCTATCGAACAGTGGGACTTC -3'
(R):5'- GAATCCAGTGTGGCAAACCTGG -3'

Sequencing Primer
(F):5'- TCGAACAGTGGGACTTCATGTAAAC -3'
(R):5'- GGCAAACCTGGTTGATAGCTC -3'
Posted On2014-08-25