Incidental Mutation 'R2038:Pabpn1'
ID225350
Institutional Source Beutler Lab
Gene Symbol Pabpn1
Ensembl Gene ENSMUSG00000022194
Gene Namepoly(A) binding protein, nuclear 1
Synonymspoly(A) binding protein II, Pabp3
MMRRC Submission 040045-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2038 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54892500-54898169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 54897152 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 250 (I250S)
Ref Sequence ENSEMBL: ENSMUSP00000112177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022808] [ENSMUST00000116476] [ENSMUST00000134077] [ENSMUST00000139985] [ENSMUST00000140691] [ENSMUST00000141446] [ENSMUST00000146271] [ENSMUST00000150975] [ENSMUST00000172557] [ENSMUST00000172695]
Predicted Effect probably damaging
Transcript: ENSMUST00000022808
AA Change: I250S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022808
Gene: ENSMUSG00000022194
AA Change: I250S

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 100 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
RRM 169 241 4.19e-17 SMART
low complexity region 283 295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000116476
AA Change: I250S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112177
Gene: ENSMUSG00000022194
AA Change: I250S

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 100 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
RRM 169 241 4.19e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134077
AA Change: I281S

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117229
Gene: ENSMUSG00000092232
AA Change: I281S

DomainStartEndE-ValueType
BH4 6 32 1.28e-11 SMART
BCL 46 144 1.22e-45 SMART
low complexity region 155 169 N/A INTRINSIC
RRM 200 272 4.19e-17 SMART
low complexity region 314 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139985
AA Change: I126S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122432
Gene: ENSMUSG00000022194
AA Change: I126S

DomainStartEndE-ValueType
RRM 45 117 4.19e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140691
AA Change: I154S

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115294
Gene: ENSMUSG00000022194
AA Change: I154S

DomainStartEndE-ValueType
coiled coil region 9 51 N/A INTRINSIC
RRM 73 145 4.19e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141446
AA Change: I126S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123305
Gene: ENSMUSG00000022194
AA Change: I126S

DomainStartEndE-ValueType
RRM 45 117 4.19e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146271
Predicted Effect probably damaging
Transcript: ENSMUST00000150975
AA Change: I277S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133937
Gene: ENSMUSG00000022194
AA Change: I277S

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 29 45 N/A INTRINSIC
low complexity region 49 100 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
RRM 169 241 3.23e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172557
AA Change: I126S

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133405
Gene: ENSMUSG00000022194
AA Change: I126S

DomainStartEndE-ValueType
RRM 45 117 4.19e-17 SMART
low complexity region 159 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172695
SMART Domains Protein: ENSMUSP00000133579
Gene: ENSMUSG00000022194

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
low complexity region 59 73 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an abundant nuclear protein that binds with high affinity to nascent poly(A) tails. The protein is required for progressive and efficient polymerization of poly(A) tails at the 3' ends of eukaryotic transcripts and controls the size of the poly(A) tail to about 250 nt. At steady-state, this protein is localized in the nucleus whereas a different poly(A) binding protein is localized in the cytoplasm. This gene contains a GCG trinucleotide repeat at the 5' end of the coding region, and expansion of this repeat from the normal 6 copies to 8-13 copies leads to autosomal dominant oculopharyngeal muscular dystrophy (OPMD) disease. Related pseudogenes have been identified on chromosomes 19 and X. Read-through transcription also exists between this gene and the neighboring upstream BCL2-like 2 (BCL2L2) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous KO and poly-alanine KI is embryonic lethal. Heterozygosity affects mitochondria and causes age- and muscle-specific muscle hypo- and hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,663,023 Y54C probably damaging Het
9030624J02Rik T C 7: 118,811,874 F677L probably damaging Het
Adgrf4 A T 17: 42,667,863 H196Q probably damaging Het
Astn1 T G 1: 158,657,120 S918A probably benign Het
Cd79a A T 7: 24,899,357 K110N probably benign Het
Cdc34b C T 11: 94,742,288 Q105* probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Clpx G A 9: 65,317,493 G168R probably damaging Het
Col8a2 T C 4: 126,311,315 probably benign Het
Ddx27 G A 2: 167,033,755 E669K probably damaging Het
Dnah8 A T 17: 30,758,281 I2898F probably damaging Het
Dus2 T C 8: 106,048,662 Y274H probably damaging Het
Dync2h1 A G 9: 6,967,226 S4073P probably damaging Het
Dynlrb2 G A 8: 116,514,810 R31Q possibly damaging Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Fhdc1 A T 3: 84,444,561 L1119Q probably benign Het
H2-T10 T C 17: 36,119,425 K212E probably benign Het
H60b A T 10: 22,286,215 N113I probably benign Het
Hace1 A C 10: 45,700,625 K798Q probably benign Het
Hdac7 C T 15: 97,798,270 R631H probably damaging Het
Kat7 T A 11: 95,300,102 I153F probably benign Het
Lman1 T C 18: 65,998,610 T101A probably benign Het
Mapk8 A T 14: 33,388,936 C245* probably null Het
Mfhas1 T A 8: 35,591,277 W969R probably damaging Het
Mlxipl A T 5: 135,106,999 D26V probably damaging Het
Msh5 A G 17: 35,046,040 V53A probably benign Het
Msl2 C A 9: 101,101,984 A519D probably damaging Het
Nbeal1 A G 1: 60,206,344 S176G probably benign Het
Ninl T A 2: 150,975,843 K134* probably null Het
Olfr1240 C A 2: 89,439,345 M311I probably benign Het
Olfr384 T A 11: 73,603,413 Y278N probably damaging Het
Olfr959 A G 9: 39,572,987 S91P probably damaging Het
Ppp4r4 G A 12: 103,576,280 probably null Het
Rad51ap2 T C 12: 11,457,024 S316P possibly damaging Het
Scn7a C A 2: 66,737,436 W271C probably damaging Het
Set T C 2: 30,070,200 S182P probably benign Het
Sez6l T C 5: 112,472,752 T321A possibly damaging Het
Sfpq A T 4: 127,021,502 H29L unknown Het
Slc33a1 A G 3: 63,948,156 L356P probably damaging Het
Sptbn1 C G 11: 30,159,293 probably null Het
Srrd C T 5: 112,338,450 G179D probably benign Het
Taf4b T C 18: 14,807,399 S312P probably damaging Het
Tgfbrap1 A T 1: 43,054,634 L566* probably null Het
Tln2 T A 9: 67,397,653 M1L probably benign Het
Ttc27 T C 17: 74,856,502 F702L probably benign Het
Vmn2r54 C T 7: 12,629,710 G419R possibly damaging Het
Vps13b A G 15: 35,884,741 S3187G probably damaging Het
Vps13d C A 4: 145,181,115 probably null Het
Zfp568 A T 7: 29,989,082 E23V probably null Het
Other mutations in Pabpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2081:Pabpn1 UTSW 14 54895658 missense probably damaging 1.00
R5236:Pabpn1 UTSW 14 54894942 missense possibly damaging 0.73
R5974:Pabpn1 UTSW 14 54897160 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTTTGCATATATAGAGTTCTCGG -3'
(R):5'- AGTAAGGGTCCTCAGGTGAG -3'

Sequencing Primer
(F):5'- TATAGAGTTCTCGGACAAAGAGTC -3'
(R):5'- CTCAGGTGAGGAGAGAACGAAGC -3'
Posted On2014-08-25