Incidental Mutation 'R2038:Taf4b'
ID225369
Institutional Source Beutler Lab
Gene Symbol Taf4b
Ensembl Gene ENSMUSG00000054321
Gene NameTATA-box binding protein associated factor 4b
SynonymsTaf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik
MMRRC Submission 040045-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R2038 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location14783245-14900359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14807399 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 312 (S312P)
Ref Sequence ENSEMBL: ENSMUSP00000126909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169862]
Predicted Effect probably damaging
Transcript: ENSMUST00000169862
AA Change: S312P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: S312P

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Pfam:TAFH 257 348 5.3e-39 PFAM
low complexity region 359 376 N/A INTRINSIC
low complexity region 412 422 N/A INTRINSIC
Pfam:TAF4 610 852 4e-72 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,663,023 Y54C probably damaging Het
9030624J02Rik T C 7: 118,811,874 F677L probably damaging Het
Adgrf4 A T 17: 42,667,863 H196Q probably damaging Het
Astn1 T G 1: 158,657,120 S918A probably benign Het
Cd79a A T 7: 24,899,357 K110N probably benign Het
Cdc34b C T 11: 94,742,288 Q105* probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Clpx G A 9: 65,317,493 G168R probably damaging Het
Col8a2 T C 4: 126,311,315 probably benign Het
Ddx27 G A 2: 167,033,755 E669K probably damaging Het
Dnah8 A T 17: 30,758,281 I2898F probably damaging Het
Dus2 T C 8: 106,048,662 Y274H probably damaging Het
Dync2h1 A G 9: 6,967,226 S4073P probably damaging Het
Dynlrb2 G A 8: 116,514,810 R31Q possibly damaging Het
Esyt1 C T 10: 128,511,951 V957I probably benign Het
Fhdc1 A T 3: 84,444,561 L1119Q probably benign Het
H2-T10 T C 17: 36,119,425 K212E probably benign Het
H60b A T 10: 22,286,215 N113I probably benign Het
Hace1 A C 10: 45,700,625 K798Q probably benign Het
Hdac7 C T 15: 97,798,270 R631H probably damaging Het
Kat7 T A 11: 95,300,102 I153F probably benign Het
Lman1 T C 18: 65,998,610 T101A probably benign Het
Mapk8 A T 14: 33,388,936 C245* probably null Het
Mfhas1 T A 8: 35,591,277 W969R probably damaging Het
Mlxipl A T 5: 135,106,999 D26V probably damaging Het
Msh5 A G 17: 35,046,040 V53A probably benign Het
Msl2 C A 9: 101,101,984 A519D probably damaging Het
Nbeal1 A G 1: 60,206,344 S176G probably benign Het
Ninl T A 2: 150,975,843 K134* probably null Het
Olfr1240 C A 2: 89,439,345 M311I probably benign Het
Olfr384 T A 11: 73,603,413 Y278N probably damaging Het
Olfr959 A G 9: 39,572,987 S91P probably damaging Het
Pabpn1 T G 14: 54,897,152 I250S probably damaging Het
Ppp4r4 G A 12: 103,576,280 probably null Het
Rad51ap2 T C 12: 11,457,024 S316P possibly damaging Het
Scn7a C A 2: 66,737,436 W271C probably damaging Het
Set T C 2: 30,070,200 S182P probably benign Het
Sez6l T C 5: 112,472,752 T321A possibly damaging Het
Sfpq A T 4: 127,021,502 H29L unknown Het
Slc33a1 A G 3: 63,948,156 L356P probably damaging Het
Sptbn1 C G 11: 30,159,293 probably null Het
Srrd C T 5: 112,338,450 G179D probably benign Het
Tgfbrap1 A T 1: 43,054,634 L566* probably null Het
Tln2 T A 9: 67,397,653 M1L probably benign Het
Ttc27 T C 17: 74,856,502 F702L probably benign Het
Vmn2r54 C T 7: 12,629,710 G419R possibly damaging Het
Vps13b A G 15: 35,884,741 S3187G probably damaging Het
Vps13d C A 4: 145,181,115 probably null Het
Zfp568 A T 7: 29,989,082 E23V probably null Het
Other mutations in Taf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Taf4b APN 18 14844420 missense probably damaging 1.00
IGL01755:Taf4b APN 18 14897985 missense probably benign
IGL01755:Taf4b APN 18 14897986 missense probably benign 0.13
IGL02049:Taf4b APN 18 14830139 missense probably benign 0.00
IGL02650:Taf4b APN 18 14841983 nonsense probably null
IGL03078:Taf4b APN 18 14813554 missense possibly damaging 0.48
IGL03169:Taf4b APN 18 14821535 missense probably damaging 1.00
IGL03261:Taf4b APN 18 14821528 missense probably benign
adirondack UTSW 18 14804578 missense probably null 0.16
R0266:Taf4b UTSW 18 14813077 splice site probably benign
R0385:Taf4b UTSW 18 14783760 missense probably benign 0.00
R1015:Taf4b UTSW 18 14813098 missense probably damaging 1.00
R1054:Taf4b UTSW 18 14821473 missense probably benign 0.00
R1416:Taf4b UTSW 18 14821427 splice site probably benign
R1435:Taf4b UTSW 18 14807409 missense probably damaging 1.00
R1609:Taf4b UTSW 18 14835881 missense probably damaging 1.00
R1611:Taf4b UTSW 18 14844469 missense probably null 1.00
R1906:Taf4b UTSW 18 14822102 missense probably benign 0.00
R2890:Taf4b UTSW 18 14804792 missense probably damaging 1.00
R4527:Taf4b UTSW 18 14821442 missense probably damaging 1.00
R4559:Taf4b UTSW 18 14813526 missense probably damaging 1.00
R4773:Taf4b UTSW 18 14804520 missense probably benign 0.30
R4857:Taf4b UTSW 18 14804578 missense probably null 0.16
R4946:Taf4b UTSW 18 14813542 missense probably damaging 1.00
R4984:Taf4b UTSW 18 14835816 missense probably damaging 1.00
R4994:Taf4b UTSW 18 14898043 missense probably damaging 0.99
R5010:Taf4b UTSW 18 14822172 missense possibly damaging 0.59
R5155:Taf4b UTSW 18 14830095 missense probably benign 0.07
R5874:Taf4b UTSW 18 14804554 missense probably benign
R6079:Taf4b UTSW 18 14822198 missense possibly damaging 0.75
R6303:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6304:Taf4b UTSW 18 14807355 missense probably damaging 1.00
R6372:Taf4b UTSW 18 14804733 missense probably damaging 1.00
R6972:Taf4b UTSW 18 14813347 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CATTTAGTTCTCTGGTGACATGAG -3'
(R):5'- CTGTTCAAATCAATACTGTGTTGGC -3'

Sequencing Primer
(F):5'- GGCCTTCAACTCATAGGCTAAAGTG -3'
(R):5'- CTGTGTTGGCTTATACTTTACAAAAG -3'
Posted On2014-08-25