Incidental Mutation 'R2122:Exoc6b'
ID229572
Institutional Source Beutler Lab
Gene Symbol Exoc6b
Ensembl Gene ENSMUSG00000033769
Gene Nameexocyst complex component 6B
SynonymsSec15b, Sec15l2, 4930569O18Rik, G430127E12Rik
MMRRC Submission 040126-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R2122 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location84618487-85069513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84621482 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 779 (M779T)
Ref Sequence ENSEMBL: ENSMUSP00000125312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160197]
Predicted Effect probably benign
Transcript: ENSMUST00000160197
AA Change: M779T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000125312
Gene: ENSMUSG00000033769
AA Change: M779T

DomainStartEndE-ValueType
coiled coil region 79 118 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
Pfam:Sec15 464 770 4.5e-105 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a part of the evolutionarily conserved exocyst, a multimeric protein complex necessary for exocytosis, which in turn, is crucial for cell growth, polarity and migration. Disruption of this gene may be associated with phenotypes exhibiting multiple symptoms including intellectual disability and developmental delay (DD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G T 7: 120,519,961 G975V probably damaging Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Actl10 G A 2: 154,552,233 R35H probably damaging Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Arhgef7 A T 8: 11,728,256 N2I possibly damaging Het
Blvra T G 2: 127,086,897 S102A probably damaging Het
Btn1a1 A G 13: 23,461,521 L226P probably damaging Het
C2cd4d G T 3: 94,363,618 E64* probably null Het
Ccna2 A G 3: 36,568,726 V209A probably damaging Het
Cd55 T A 1: 130,459,617 D148V possibly damaging Het
Cdh2 G A 18: 16,774,543 P46L probably benign Het
Cldn11 A G 3: 31,163,151 Y156C probably damaging Het
Cmtm2a T C 8: 104,293,023 R12G possibly damaging Het
Cog2 T C 8: 124,528,985 S104P possibly damaging Het
Col4a3 T G 1: 82,654,957 F184V unknown Het
Col4a4 T A 1: 82,456,871 D1406V unknown Het
Col6a1 T C 10: 76,721,498 T207A probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Eif2ak4 T A 2: 118,455,793 V1063E probably damaging Het
Enpp2 A T 15: 54,897,792 Y44* probably null Het
Ep400 A T 5: 110,708,850 probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Fscn3 A G 6: 28,430,389 D186G probably benign Het
Gm5773 G A 3: 93,773,317 G99R possibly damaging Het
Grk1 A T 8: 13,405,221 Y35F probably benign Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Hfm1 A G 5: 106,896,255 S567P probably damaging Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Krtap5-5 A T 7: 142,229,503 C137S unknown Het
Lrp2 T C 2: 69,483,707 T2227A probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Map1a T A 2: 121,299,446 Y248N probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mfsd4b1 T C 10: 40,002,651 K417E possibly damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh11 T C 16: 14,218,004 E1027G probably damaging Het
Nudt6 A C 3: 37,412,405 F80L probably benign Het
Nxph1 A G 6: 9,247,791 K254R probably damaging Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr17 A T 7: 107,098,109 I215F probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Phldb2 T A 16: 45,762,941 I1065F probably damaging Het
Ppp1r3a A T 6: 14,721,875 N317K possibly damaging Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reg3a T C 6: 78,381,136 C17R possibly damaging Het
Ripor2 A G 13: 24,713,718 S800G probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Rnf31 A G 14: 55,596,197 D554G probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sacs A T 14: 61,212,316 Q3937L probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc20a1 T G 2: 129,199,819 I34S possibly damaging Het
Slc25a30 A G 14: 75,770,218 S116P possibly damaging Het
Speer4c T A 5: 15,714,117 D29V possibly damaging Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Susd3 A G 13: 49,231,150 Y254H probably damaging Het
Tanc2 T C 11: 105,895,949 L858P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tfpt C T 7: 3,628,931 R60Q probably damaging Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Tnfsf9 A T 17: 57,107,316 probably null Het
Ube3c T C 5: 29,619,606 I543T probably benign Het
Ugt1a2 C A 1: 88,201,013 S126Y possibly damaging Het
Vmn1r180 T A 7: 23,953,141 L243Q probably damaging Het
Vmn2r15 A C 5: 109,286,456 V794G probably damaging Het
Vmn2r24 A G 6: 123,815,394 D560G possibly damaging Het
Wdr11 G A 7: 129,631,766 C1028Y probably damaging Het
Zfp318 A G 17: 46,413,371 D2100G probably benign Het
Zfyve16 A T 13: 92,519,483 Y789* probably null Het
Other mutations in Exoc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Exoc6b APN 6 84989453 missense probably benign 0.08
IGL01148:Exoc6b APN 6 84908226 missense probably benign 0.18
IGL01804:Exoc6b APN 6 84908166 missense probably damaging 0.98
IGL01817:Exoc6b APN 6 85069338 missense probably damaging 1.00
IGL01912:Exoc6b APN 6 84625174 missense probably damaging 1.00
IGL02441:Exoc6b APN 6 85005008 missense probably damaging 1.00
IGL02947:Exoc6b APN 6 84858429 missense probably benign
IGL02996:Exoc6b APN 6 84908213 missense probably benign 0.01
IGL03132:Exoc6b APN 6 84791264 missense possibly damaging 0.46
IGL03338:Exoc6b APN 6 84844130 missense probably damaging 0.99
R0003:Exoc6b UTSW 6 84854699 critical splice donor site probably null
R0732:Exoc6b UTSW 6 84855522 missense probably damaging 0.99
R1137:Exoc6b UTSW 6 84908223 missense probably benign
R1381:Exoc6b UTSW 6 84835117 missense probably benign
R1723:Exoc6b UTSW 6 85069344 missense probably damaging 1.00
R1838:Exoc6b UTSW 6 84853678 missense probably benign 0.04
R1866:Exoc6b UTSW 6 84851914 missense probably damaging 0.99
R2138:Exoc6b UTSW 6 84989482 missense probably damaging 1.00
R2357:Exoc6b UTSW 6 84989339 missense possibly damaging 0.60
R2987:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R2988:Exoc6b UTSW 6 84851947 missense probably damaging 0.96
R3415:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R3417:Exoc6b UTSW 6 84890565 missense possibly damaging 0.81
R4364:Exoc6b UTSW 6 85003179 intron probably benign
R4610:Exoc6b UTSW 6 85003159 intron probably benign
R4624:Exoc6b UTSW 6 84854809 splice site probably benign
R4845:Exoc6b UTSW 6 84835137 missense probably benign 0.04
R5366:Exoc6b UTSW 6 84890531 missense probably benign
R5603:Exoc6b UTSW 6 84835144 missense possibly damaging 0.96
R5635:Exoc6b UTSW 6 84851927 missense probably damaging 0.99
R5728:Exoc6b UTSW 6 84860191 missense probably damaging 1.00
R6188:Exoc6b UTSW 6 84855497 missense probably damaging 0.99
R7030:Exoc6b UTSW 6 84848825 missense probably damaging 0.99
R7058:Exoc6b UTSW 6 84854722 missense probably damaging 1.00
R7259:Exoc6b UTSW 6 84848810 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CTCTCTTTGAGGAAGAATGCAC -3'
(R):5'- CAAAGGCTTGTTGTCAGGAAGG -3'

Sequencing Primer
(F):5'- CTCTTTGAGGAAGAATGCACAAATGC -3'
(R):5'- TCCATAATGAGTAGGTAGCTGGAC -3'
Posted On2014-09-17