Incidental Mutation 'R2120:Unc45a'
ID231376
Institutional Source Beutler Lab
Gene Symbol Unc45a
Ensembl Gene ENSMUSG00000030533
Gene Nameunc-45 myosin chaperone A
Synonyms
MMRRC Submission 040124-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R2120 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80325292-80341005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80340098 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 8 (T8A)
Ref Sequence ENSEMBL: ENSMUSP00000102991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032747] [ENSMUST00000032748] [ENSMUST00000107368] [ENSMUST00000127997] [ENSMUST00000133728] [ENSMUST00000154428] [ENSMUST00000205531] [ENSMUST00000205744] [ENSMUST00000205768] [ENSMUST00000206074] [ENSMUST00000206089] [ENSMUST00000206122] [ENSMUST00000206480]
Predicted Effect probably benign
Transcript: ENSMUST00000032747
SMART Domains Protein: ENSMUSP00000032747
Gene: ENSMUSG00000030532

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
HDc 28 136 1.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032748
AA Change: T8A

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533
AA Change: T8A

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107368
AA Change: T8A

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533
AA Change: T8A

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127997
SMART Domains Protein: ENSMUSP00000114428
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
Pfam:TPR_11 4 74 8.4e-19 PFAM
Pfam:TPR_1 6 36 2.3e-6 PFAM
Pfam:TPR_2 6 37 2.6e-6 PFAM
Pfam:TPR_16 10 82 1e-7 PFAM
Pfam:TPR_1 43 69 4.4e-4 PFAM
Pfam:TPR_2 43 74 3.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133728
SMART Domains Protein: ENSMUSP00000123399
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
TPR 6 39 9.53e-2 SMART
TPR 43 76 5.48e-2 SMART
TPR 77 110 7.45e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145351
Predicted Effect probably benign
Transcript: ENSMUST00000154428
AA Change: T8A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533
AA Change: T8A

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205448
Predicted Effect probably benign
Transcript: ENSMUST00000205531
Predicted Effect probably benign
Transcript: ENSMUST00000205744
Predicted Effect probably benign
Transcript: ENSMUST00000205768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206032
Predicted Effect probably benign
Transcript: ENSMUST00000206074
Predicted Effect probably benign
Transcript: ENSMUST00000206089
Predicted Effect probably benign
Transcript: ENSMUST00000206122
Predicted Effect probably benign
Transcript: ENSMUST00000206363
Predicted Effect probably benign
Transcript: ENSMUST00000206480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206494
Predicted Effect probably benign
Transcript: ENSMUST00000206559
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC45A plays a role in cell proliferation and myoblast fusion, binds progesterone receptor (PGR; MIM 607311) and HSP90 (HSPCA; MIM 140571), and acts as a regulator of the progesterone receptor chaperoning pathway (Price et al., 2002 [PubMed 12356907]; Chadli et al., 2006 [PubMed 16478993]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Actrt2 C T 4: 154,667,094 R195Q probably benign Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Ankrd65 A G 4: 155,792,073 T239A probably benign Het
Ano7 G T 1: 93,402,133 probably benign Het
Apc A T 18: 34,276,601 E198V probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Atp9a A T 2: 168,653,537 V583E probably damaging Het
Bicral C T 17: 46,824,815 A490T probably benign Het
C1rl C T 6: 124,508,713 P348S probably damaging Het
Cog1 T C 11: 113,649,598 L13P probably damaging Het
Cx3cr1 T A 9: 120,051,683 T218S probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dmd G C X: 84,312,483 A2257P probably benign Het
E2f4 A G 8: 105,300,341 Y179C probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Endod1 T C 9: 14,357,653 N179D probably benign Het
Epc2 C T 2: 49,547,609 probably benign Het
Ets2 G T 16: 95,718,933 R401L probably benign Het
Fgd4 C T 16: 16,425,828 C614Y probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Frem3 A T 8: 80,615,457 T1460S probably benign Het
H2-M1 T G 17: 36,670,037 T336P possibly damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Ipo7 G T 7: 110,049,631 D704Y probably damaging Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Jarid2 G T 13: 44,906,336 M681I probably benign Het
Kif4-ps T C 12: 101,147,697 L695P probably damaging Het
Kmt2d A G 15: 98,839,529 probably benign Het
Krt25 T C 11: 99,321,197 T205A probably benign Het
Lif T C 11: 4,269,051 V110A possibly damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Man2b1 A G 8: 85,093,024 probably benign Het
Med16 A T 10: 79,903,082 M290K possibly damaging Het
Mov10l1 C A 15: 89,007,627 Q562K probably benign Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Mtmr6 T C 14: 60,296,659 F449L probably damaging Het
Myt1l A T 12: 29,783,619 probably null Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1054 G A 2: 86,333,345 R4C probably benign Het
Olfr1280 A G 2: 111,315,499 T7A probably benign Het
Olfr213 A T 6: 116,540,455 M1L probably null Het
Olfr743 T C 14: 50,533,946 I178T probably damaging Het
Patj T A 4: 98,456,225 D591E probably benign Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Pitpnm2 G A 5: 124,127,269 P757L probably damaging Het
Plcd4 A G 1: 74,564,425 T662A probably benign Het
Podn C T 4: 108,023,361 A31T probably damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rab3gap2 A T 1: 185,261,367 D782V possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reln G A 5: 21,969,085 H2007Y probably damaging Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Rimbp2 A G 5: 128,788,518 S582P probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sars T C 3: 108,434,156 I114V probably benign Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sec14l1 C T 11: 117,148,532 probably benign Het
Serpinb8 A G 1: 107,605,887 E224G probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slco6c1 C T 1: 97,066,083 R645H possibly damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Srgn T A 10: 62,507,634 probably benign Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tada3 T C 6: 113,371,015 I263V possibly damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r115 T A 6: 132,737,507 R160S possibly damaging Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Trp53bp2 A G 1: 182,441,639 M223V probably benign Het
Ttc21b C T 2: 66,226,754 V625I probably benign Het
Txnrd1 T A 10: 82,887,233 C421S possibly damaging Het
Usp6nl T A 2: 6,440,937 V552E probably damaging Het
Vmn2r115 T G 17: 23,359,323 L590R probably damaging Het
Vmn2r88 A T 14: 51,413,208 H126L probably benign Het
Vps13c A G 9: 67,919,334 D1419G possibly damaging Het
Vwa3a A G 7: 120,792,418 T776A probably benign Het
Zfp580 T C 7: 5,053,009 Y123H probably damaging Het
Other mutations in Unc45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02252:Unc45a APN 7 80332969 intron probably benign
IGL02266:Unc45a APN 7 80328486 missense probably damaging 0.96
IGL02383:Unc45a APN 7 80339662 nonsense probably null
IGL02959:Unc45a APN 7 80332973 intron probably benign
IGL03168:Unc45a APN 7 80333133 missense probably damaging 1.00
PIT4131001:Unc45a UTSW 7 80326361 missense possibly damaging 0.74
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0276:Unc45a UTSW 7 80326297 intron probably benign
R0373:Unc45a UTSW 7 80326344 missense probably damaging 0.97
R1827:Unc45a UTSW 7 80331740 missense possibly damaging 0.77
R2440:Unc45a UTSW 7 80329057 missense probably damaging 1.00
R2442:Unc45a UTSW 7 80339669 missense probably damaging 1.00
R2508:Unc45a UTSW 7 80338875 missense probably benign
R3077:Unc45a UTSW 7 80338932 missense probably damaging 0.97
R3108:Unc45a UTSW 7 80331546 intron probably benign
R3109:Unc45a UTSW 7 80331546 intron probably benign
R3620:Unc45a UTSW 7 80334051 missense possibly damaging 0.84
R4471:Unc45a UTSW 7 80332980 missense possibly damaging 0.94
R4644:Unc45a UTSW 7 80328509 missense probably damaging 1.00
R4651:Unc45a UTSW 7 80333029 missense possibly damaging 0.93
R4838:Unc45a UTSW 7 80333035 missense probably damaging 1.00
R5234:Unc45a UTSW 7 80328799 missense probably benign 0.17
R5452:Unc45a UTSW 7 80329039 missense probably damaging 1.00
R5574:Unc45a UTSW 7 80334856 missense probably damaging 0.98
R5750:Unc45a UTSW 7 80334823 missense probably benign 0.17
R6169:Unc45a UTSW 7 80328763 missense possibly damaging 0.92
R6417:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6420:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6486:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6533:Unc45a UTSW 7 80334069 missense probably damaging 1.00
R6734:Unc45a UTSW 7 80336998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTTGAACAGCTCGTTGCC -3'
(R):5'- TCCAGTGGGAACAGACTAGG -3'

Sequencing Primer
(F):5'- TGAGCTGGCCTGGAGAG -3'
(R):5'- AACAGACTAGGCGCTCGTG -3'
Posted On2014-09-18