Incidental Mutation 'R2149:Sorbs2'
ID234112
Institutional Source Beutler Lab
Gene Symbol Sorbs2
Ensembl Gene ENSMUSG00000031626
Gene Namesorbin and SH3 domain containing 2
Synonyms
MMRRC Submission 040152-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2149 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45507788-45827906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45795443 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 442 (D442A)
Ref Sequence ENSEMBL: ENSMUSP00000070720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000153798] [ENSMUST00000171337] [ENSMUST00000211095]
Predicted Effect probably damaging
Transcript: ENSMUST00000067065
AA Change: D442A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626
AA Change: D442A

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
low complexity region 136 154 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 362 373 N/A INTRINSIC
low complexity region 606 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
SH3 845 900 5.1e-23 SMART
low complexity region 901 916 N/A INTRINSIC
SH3 920 977 3.9e-19 SMART
SH3 1023 1079 2.48e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000067107
AA Change: D558A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626
AA Change: D558A

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000125295
AA Change: D497A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626
AA Change: D497A

DomainStartEndE-ValueType
Sorb 6 56 9.63e-34 SMART
low complexity region 103 116 N/A INTRINSIC
low complexity region 160 176 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
SH3 900 955 5.1e-23 SMART
low complexity region 956 971 N/A INTRINSIC
SH3 975 1032 3.9e-19 SMART
SH3 1078 1134 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130011
SMART Domains Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 113 163 1.01e-27 SMART
low complexity region 195 208 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 366 383 N/A INTRINSIC
SH3 418 473 5.1e-23 SMART
low complexity region 474 489 N/A INTRINSIC
SH3 493 550 3.9e-19 SMART
SH3 596 652 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132139
SMART Domains Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
low complexity region 298 314 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
low complexity region 431 448 N/A INTRINSIC
SH3 483 538 5.1e-23 SMART
low complexity region 539 554 N/A INTRINSIC
SH3 558 615 3.9e-19 SMART
SH3 636 707 2.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135116
Predicted Effect possibly damaging
Transcript: ENSMUST00000135336
AA Change: D558A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626
AA Change: D558A

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138049
SMART Domains Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 1.01e-27 SMART
low complexity region 249 262 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139869
SMART Domains Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 1.01e-27 SMART
low complexity region 218 231 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
SH3 389 444 5.1e-23 SMART
low complexity region 445 460 N/A INTRINSIC
SH3 464 521 3.9e-19 SMART
SH3 567 623 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140088
SMART Domains Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 2 25 9.17e-1 SMART
low complexity region 57 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146627
SMART Domains Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
low complexity region 41 59 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153798
SMART Domains Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 9.63e-34 SMART
low complexity region 233 246 N/A INTRINSIC
low complexity region 351 368 N/A INTRINSIC
SH3 403 458 5.1e-23 SMART
low complexity region 459 474 N/A INTRINSIC
SH3 478 535 3.9e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155858
SMART Domains Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
low complexity region 138 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171337
AA Change: D577A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626
AA Change: D577A

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 754 765 N/A INTRINSIC
SH3 980 1035 5.1e-23 SMART
low complexity region 1036 1051 N/A INTRINSIC
SH3 1055 1112 3.9e-19 SMART
SH3 1158 1214 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211095
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik A G 1: 43,742,336 D126G probably damaging Het
1700006A11Rik T C 3: 124,409,686 E414G probably benign Het
3632451O06Rik T C 14: 49,751,571 D647G probably benign Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Abca13 A G 11: 9,267,508 T317A possibly damaging Het
Acap3 T G 4: 155,905,625 L750R probably damaging Het
Anapc7 T A 5: 122,443,826 S511T probably benign Het
Anp32a T A 9: 62,371,802 F46Y probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arid2 T C 15: 96,370,835 I943T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC003331 A T 1: 150,388,559 N66K probably benign Het
Btnl6 T C 17: 34,514,347 N218S possibly damaging Het
Capn11 T C 17: 45,633,107 probably null Het
Clcnkb C T 4: 141,408,017 G470D probably damaging Het
Clic6 T A 16: 92,499,207 S252T probably benign Het
Col28a1 T C 6: 8,155,383 K318E possibly damaging Het
Col5a3 A T 9: 20,771,270 V1626D unknown Het
Col6a4 C A 9: 106,076,929 A404S probably benign Het
Cyp2j5 G T 4: 96,641,340 H265N possibly damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Emilin2 T C 17: 71,273,992 S580G probably benign Het
Fbn2 C A 18: 58,102,325 probably null Het
Gfm1 T C 3: 67,474,560 L693P probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gpha2 A G 19: 6,226,982 T38A probably damaging Het
Gtf2h3 T C 5: 124,599,785 probably benign Het
Hmgxb3 T C 18: 61,157,674 T376A probably benign Het
Hspa12b A G 2: 131,143,057 D416G probably damaging Het
Immt C T 6: 71,844,675 R28* probably null Het
Iqgap1 T C 7: 80,762,560 Y180C probably damaging Het
Kcnq3 T A 15: 66,023,729 D322V probably damaging Het
Kifc2 C A 15: 76,662,221 L268I probably benign Het
Lama1 T C 17: 67,773,865 M1296T possibly damaging Het
Lipk A G 19: 34,021,617 N104S possibly damaging Het
Lrrc14b T A 13: 74,363,757 N68I possibly damaging Het
Lrrc28 A T 7: 67,531,682 D268E probably damaging Het
Ly6c2 T C 15: 75,108,543 *132W probably null Het
Msh6 A G 17: 87,986,088 E757G probably damaging Het
Mtss1l T C 8: 110,726,383 V47A possibly damaging Het
Muc2 CGTG CGTGTG 7: 141,699,185 probably null Het
Nalcn A T 14: 123,370,017 I680N probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1501 A C 19: 13,838,582 V197G probably damaging Het
Olfr61 C T 7: 140,638,052 T117M probably damaging Het
Olfr713 A T 7: 107,036,338 Y61F possibly damaging Het
Olfr912 T C 9: 38,581,508 V77A probably benign Het
Oosp2 A T 19: 11,649,614 L17* probably null Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pde4dip T A 3: 97,792,836 Q300L possibly damaging Het
Phf2 T C 13: 48,804,689 K950E unknown Het
Pira2 G A 7: 3,844,171 P124L probably damaging Het
Plpp4 C T 7: 129,379,371 T157I probably benign Het
Polrmt G A 10: 79,740,275 Q545* probably null Het
Ptprs A G 17: 56,417,706 F1511L probably damaging Het
Sbno1 T C 5: 124,402,119 probably null Het
Setd1a T A 7: 127,786,518 V256D possibly damaging Het
Slamf1 T C 1: 171,767,272 S16P probably damaging Het
Slc16a14 T C 1: 84,907,399 D473G probably damaging Het
Slc8a2 A T 7: 16,159,164 H917L probably damaging Het
Srp68 G T 11: 116,260,867 T301K possibly damaging Het
Stab2 A T 10: 86,865,040 C457* probably null Het
Stk31 T G 6: 49,439,218 S652R possibly damaging Het
Stra6 T G 9: 58,152,539 S594R probably benign Het
Tbc1d9 G A 8: 83,271,449 E1212K probably damaging Het
Thada C T 17: 84,441,764 R593Q probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem132c T A 5: 127,462,962 W351R probably damaging Het
Tmem206 T G 1: 191,345,109 F210V probably benign Het
Trim10 C T 17: 36,877,014 A374V probably benign Het
Try10 T C 6: 41,356,561 V80A probably benign Het
Ttn T C 2: 76,729,363 T29565A possibly damaging Het
Uggt2 G T 14: 119,075,345 Q351K probably benign Het
Vmn1r120 A T 7: 21,052,964 V274D probably damaging Het
Vmn1r62 A T 7: 5,675,359 H13L probably benign Het
Vmn2r101 C T 17: 19,588,963 T118I probably benign Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Wnt5a A G 14: 28,513,317 Y86C probably damaging Het
Xpa T C 4: 46,183,189 E200G probably damaging Het
Zc3h12a C T 4: 125,126,642 R136K possibly damaging Het
Zc3hav1 T C 6: 38,336,537 H191R probably damaging Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Sorbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Sorbs2 APN 8 45799706 splice site probably null
IGL00964:Sorbs2 APN 8 45795677 missense probably damaging 0.97
IGL01101:Sorbs2 APN 8 45745423 missense possibly damaging 0.93
IGL01586:Sorbs2 APN 8 45795594 missense probably damaging 1.00
IGL01611:Sorbs2 APN 8 45795344 missense probably null
IGL01662:Sorbs2 APN 8 45803829 splice site probably benign
IGL01970:Sorbs2 APN 8 45745803 missense probably damaging 1.00
IGL02169:Sorbs2 APN 8 45823749 missense probably damaging 0.98
IGL02685:Sorbs2 APN 8 45803840 missense probably benign 0.00
IGL03036:Sorbs2 APN 8 45782865 missense probably benign
IGL03151:Sorbs2 APN 8 45799713 missense probably benign 0.01
IGL03164:Sorbs2 APN 8 45782874 missense probably benign 0.01
IGL03350:Sorbs2 APN 8 45805807 missense probably damaging 0.99
R0058:Sorbs2 UTSW 8 45785254 splice site probably null
R0058:Sorbs2 UTSW 8 45796263 missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R0265:Sorbs2 UTSW 8 45785337 splice site probably benign
R0306:Sorbs2 UTSW 8 45795730 missense probably benign 0.00
R0308:Sorbs2 UTSW 8 45795130 nonsense probably null
R0638:Sorbs2 UTSW 8 45796310 missense probably damaging 1.00
R0940:Sorbs2 UTSW 8 45796502 missense probably benign 0.39
R1110:Sorbs2 UTSW 8 45795730 missense probably benign 0.13
R1160:Sorbs2 UTSW 8 45770576 missense probably damaging 1.00
R1226:Sorbs2 UTSW 8 45795619 missense probably damaging 1.00
R1271:Sorbs2 UTSW 8 45795967 missense probably damaging 1.00
R1440:Sorbs2 UTSW 8 45789963 splice site probably benign
R1514:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R1557:Sorbs2 UTSW 8 45759197 splice site probably benign
R1582:Sorbs2 UTSW 8 45805777 missense probably damaging 0.99
R1626:Sorbs2 UTSW 8 45769854 missense probably damaging 1.00
R1700:Sorbs2 UTSW 8 45800984 missense probably damaging 1.00
R1759:Sorbs2 UTSW 8 45763019 makesense probably null
R1766:Sorbs2 UTSW 8 45770576 missense probably damaging 1.00
R1782:Sorbs2 UTSW 8 45805696 missense probably damaging 1.00
R1932:Sorbs2 UTSW 8 45796352 missense probably benign 0.01
R1954:Sorbs2 UTSW 8 45745738 missense probably benign 0.23
R2060:Sorbs2 UTSW 8 45775629 missense probably damaging 1.00
R2568:Sorbs2 UTSW 8 45795370 nonsense probably null
R3812:Sorbs2 UTSW 8 45763030 missense probably benign 0.00
R3831:Sorbs2 UTSW 8 45795095 missense probably damaging 1.00
R3975:Sorbs2 UTSW 8 45772710 critical splice donor site probably null
R4033:Sorbs2 UTSW 8 45775595 missense probably damaging 1.00
R4714:Sorbs2 UTSW 8 45795293 missense possibly damaging 0.89
R4828:Sorbs2 UTSW 8 45741615 intron probably benign
R4926:Sorbs2 UTSW 8 45796217 missense probably benign 0.03
R5027:Sorbs2 UTSW 8 45746534 intron probably null
R5118:Sorbs2 UTSW 8 45795785 missense probably damaging 1.00
R5159:Sorbs2 UTSW 8 45795730 missense probably benign 0.00
R5342:Sorbs2 UTSW 8 45796013 missense probably damaging 0.96
R5390:Sorbs2 UTSW 8 45819741 missense probably damaging 1.00
R5436:Sorbs2 UTSW 8 45796001 missense probably damaging 1.00
R5655:Sorbs2 UTSW 8 45741581 critical splice donor site probably null
R5687:Sorbs2 UTSW 8 45775632 missense probably damaging 1.00
R5695:Sorbs2 UTSW 8 45792875 missense probably benign 0.27
R5733:Sorbs2 UTSW 8 45759189 missense probably damaging 1.00
R5928:Sorbs2 UTSW 8 45763183 missense probably damaging 1.00
R5949:Sorbs2 UTSW 8 45769897 critical splice donor site probably null
R6341:Sorbs2 UTSW 8 45770578 missense probably damaging 1.00
R6620:Sorbs2 UTSW 8 45796176 missense probably damaging 1.00
R6761:Sorbs2 UTSW 8 45772614 missense probably damaging 1.00
R7349:Sorbs2 UTSW 8 45795823 nonsense probably null
R7524:Sorbs2 UTSW 8 45795656 missense not run
Predicted Primers PCR Primer
(F):5'- TGAATGACGACTGCGACAGC -3'
(R):5'- AGACTTCGACTTCTGAATCAGC -3'

Sequencing Primer
(F):5'- CCAAGTCAGAGAGTATGGGTTCTC -3'
(R):5'- CTTTTCAAATTCCGAAATGCGAGTGG -3'
Posted On2014-10-01