Incidental Mutation 'R2198:Ctse'
ID238473
Institutional Source Beutler Lab
Gene Symbol Ctse
Ensembl Gene ENSMUSG00000004552
Gene Namecathepsin E
SynonymsCatE, C920004C08Rik, CE, A430072O03Rik
MMRRC Submission 040200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2198 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131638306-131675505 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 131672447 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 311 (Y311*)
Ref Sequence ENSEMBL: ENSMUSP00000073072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073350] [ENSMUST00000112411]
Predicted Effect probably null
Transcript: ENSMUST00000073350
AA Change: Y311*
SMART Domains Protein: ENSMUSP00000073072
Gene: ENSMUSG00000004552
AA Change: Y311*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:A1_Propeptide 22 50 7e-14 PFAM
Pfam:Asp 78 395 2.1e-129 PFAM
Pfam:TAXi_N 79 236 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112411
SMART Domains Protein: ENSMUSP00000108030
Gene: ENSMUSG00000004552

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:A1_Propeptide 22 50 2.7e-12 PFAM
Pfam:Asp 78 315 2e-99 PFAM
Pfam:TAXi_N 79 236 6.1e-14 PFAM
Pfam:Asp 310 362 6.8e-17 PFAM
Meta Mutation Damage Score 0.618 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartate proteases and preproprotein that is proteolytically processed to generate a mature protein product. The encoded protein may be involved in antigen processing and the maturation of secretory proteins. Elevated expression of this gene has been observed in neurodegeneration. Homozygous knockout mice for this gene exhibit lysosomal storage disorder, impaired autophagy, mitochondrial abnormalities, dermatitis, and reduced weight gain in an obesity model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile, but develop skin lesions on the face, ears, neck and dorsal skin which are similar to those seen in human atopic dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932431P20Rik G T 7: 29,527,272 noncoding transcript Het
Adra1a T C 14: 66,637,936 I120T probably damaging Het
Akr1c21 C T 13: 4,577,465 P186L probably damaging Het
Alpk2 T C 18: 65,350,184 K251R probably benign Het
Ank2 T C 3: 126,934,577 E789G possibly damaging Het
Bag3 AAAGG AAAGGAAGG 7: 128,545,769 probably null Het
Cacna2d4 T C 6: 119,347,259 probably benign Het
Carf G A 1: 60,141,484 R355H probably damaging Het
Cdh20 A T 1: 104,947,322 probably null Het
Celf6 G T 9: 59,603,339 L169F possibly damaging Het
Cep295nl A T 11: 118,332,593 I475N probably benign Het
Chdh T A 14: 30,031,532 S133T possibly damaging Het
Cnot6l C T 5: 96,079,941 D478N possibly damaging Het
Ctnna3 C A 10: 65,002,745 T867K probably benign Het
Ddx60 T A 8: 61,958,063 M453K possibly damaging Het
Dnah9 A G 11: 65,859,499 F3927L possibly damaging Het
Dsg4 T C 18: 20,461,442 S543P probably benign Het
Dspp A T 5: 104,175,701 T237S probably benign Het
Eml6 T G 11: 29,850,935 H357P probably benign Het
Epha3 T C 16: 63,844,144 I38V possibly damaging Het
Erap1 C T 13: 74,646,687 T155I probably damaging Het
Erh T C 12: 80,642,785 probably benign Het
F5 A T 1: 164,207,034 K1834M probably damaging Het
Fyn A G 10: 39,529,545 E269G probably benign Het
Gm4884 A G 7: 41,040,805 T42A probably benign Het
Gm8979 T A 7: 106,083,551 M166L probably benign Het
Grm1 T G 10: 10,782,776 R323S probably damaging Het
Gstt4 T C 10: 75,822,401 D8G probably damaging Het
Ldlr A G 9: 21,732,402 D94G probably damaging Het
Mrpl54 G A 10: 81,265,741 probably null Het
Naip2 A T 13: 100,152,592 F1210Y probably damaging Het
Nifk A G 1: 118,329,400 R88G probably benign Het
Nlgn1 C T 3: 25,433,761 M803I probably damaging Het
Olfr1388 C T 11: 49,443,959 S36F probably benign Het
Olfr1537 G A 9: 39,237,752 T224I possibly damaging Het
Olfr458 A G 6: 42,461,016 M1T probably null Het
Olfr794 T A 10: 129,571,046 Y130* probably null Het
Pip4k2a A T 2: 18,847,655 M272K probably damaging Het
Ppp1cb G T 5: 32,483,360 C139F probably damaging Het
Rad23b G A 4: 55,385,497 G345R possibly damaging Het
Shc4 A T 2: 125,639,346 V548E possibly damaging Het
Slc26a9 A G 1: 131,763,263 probably benign Het
Slc8a1 T A 17: 81,408,256 K783* probably null Het
Sobp A C 10: 43,022,524 I355S possibly damaging Het
Thbs4 A G 13: 92,763,271 Y491H possibly damaging Het
Tle2 T C 10: 81,590,313 V727A probably damaging Het
Tmprss9 C T 10: 80,887,459 P251L probably damaging Het
Tnks A T 8: 34,848,649 D994E probably benign Het
Tnks C T 8: 34,873,067 D466N probably benign Het
Tonsl A G 15: 76,636,672 F394L probably benign Het
Trpa1 T A 1: 14,910,746 Y144F probably benign Het
Usp22 A G 11: 61,159,337 F324S probably damaging Het
Vmn1r78 G T 7: 12,152,560 V33F probably benign Het
Wdr81 C T 11: 75,446,081 R1494Q probably benign Het
Zc3h14 G A 12: 98,752,809 M144I probably damaging Het
Zc3h14 G A 12: 98,752,810 V145M possibly damaging Het
Zfp82 T C 7: 30,057,511 T49A probably benign Het
Other mutations in Ctse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Ctse APN 1 131672535 missense probably benign 0.00
IGL02492:Ctse APN 1 131668234 missense probably damaging 1.00
R0057:Ctse UTSW 1 131663371 missense probably damaging 1.00
R0057:Ctse UTSW 1 131663371 missense probably damaging 1.00
R0690:Ctse UTSW 1 131674778 splice site probably benign
R4190:Ctse UTSW 1 131662741 missense probably benign 0.02
R4668:Ctse UTSW 1 131662749 missense probably damaging 1.00
R4971:Ctse UTSW 1 131664392 missense probably damaging 1.00
R5070:Ctse UTSW 1 131668179 missense probably damaging 1.00
R5499:Ctse UTSW 1 131672513 nonsense probably null
R5705:Ctse UTSW 1 131664374 missense possibly damaging 0.82
R7207:Ctse UTSW 1 131664374 missense possibly damaging 0.82
X0067:Ctse UTSW 1 131670772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGTGATGTTCTGCTCCG -3'
(R):5'- CTCATGTAGATGACTTTGAAGGGG -3'

Sequencing Primer
(F):5'- ATAGTGGACACAGGGACCTCTCTC -3'
(R):5'- TGACTTTGAAGGGGGAAGTGGC -3'
Posted On2014-10-02