Incidental Mutation 'R2209:Ptprb'
ID239264
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission 040211-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2209 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116369357 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 2159 (H2159R)
Ref Sequence ENSEMBL: ENSMUSP00000151821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092167
AA Change: H1872R

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: H1872R

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218553
AA Change: H2159R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,157,488 E330G possibly damaging Het
Apob A C 12: 8,007,752 D2078A probably benign Het
Arhgap21 T A 2: 20,849,520 Q1681L probably damaging Het
Arsb A G 13: 93,862,101 T306A probably benign Het
Brpf3 G A 17: 28,828,420 D1053N probably damaging Het
Ccdc130 C T 8: 84,263,869 V45I probably benign Het
Cenpf A T 1: 189,652,598 I2495N probably benign Het
Col12a1 T C 9: 79,692,352 K840E possibly damaging Het
Cry1 A G 10: 85,146,755 L269P probably damaging Het
Cyp21a1 C A 17: 34,802,727 E289* probably null Het
Dcp2 A T 18: 44,405,514 K215* probably null Het
Ecm2 A G 13: 49,530,156 N537D probably damaging Het
Emid1 G A 11: 5,135,407 T113M probably benign Het
Exoc8 C T 8: 124,896,179 W483* probably null Het
Fes A T 7: 80,380,283 N582K probably damaging Het
Flnb G T 14: 7,905,507 E1086* probably null Het
Flnc T A 6: 29,455,845 D2058E possibly damaging Het
Gatb G A 3: 85,653,805 D543N probably benign Het
Gm14412 A G 2: 177,317,436 V9A probably damaging Het
Gm4884 T C 7: 41,043,321 V238A possibly damaging Het
Igfbp5 A G 1: 72,873,937 V68A possibly damaging Het
Igflr1 T A 7: 30,567,797 I330N probably damaging Het
Il1r2 A G 1: 40,115,138 T222A probably benign Het
Krt87 T C 15: 101,433,108 E419G probably benign Het
Lman2 A G 13: 55,351,502 S187P probably damaging Het
Lrrc6 A G 15: 66,449,551 I247T probably benign Het
Mrpl38 T C 11: 116,138,462 E76G possibly damaging Het
Mtx3 A G 13: 92,847,604 I130V probably benign Het
Naf1 T G 8: 66,860,536 probably benign Het
Nkx2-1 T G 12: 56,533,508 M216L probably benign Het
Notch1 C A 2: 26,460,007 V2374L probably benign Het
Nrxn2 A G 19: 6,493,007 D1087G probably benign Het
Nudt8 T C 19: 4,001,902 F171S probably damaging Het
Olfr1434 T G 19: 12,283,860 F271V probably benign Het
Pds5a A T 5: 65,628,014 C916* probably null Het
Phyhip A T 14: 70,461,894 N46Y probably damaging Het
Pomt1 A G 2: 32,250,862 Y502C possibly damaging Het
Prkcg A C 7: 3,303,581 probably benign Het
Prl8a6 C T 13: 27,435,386 E118K probably benign Het
Prpf39 T C 12: 65,057,915 probably null Het
Ripor2 A T 13: 24,701,612 D571V probably damaging Het
Rps19 C T 7: 24,885,127 L34F probably benign Het
Rusc1 A G 3: 89,088,821 S145P probably damaging Het
Scn4a T A 11: 106,339,225 T586S probably damaging Het
Slc7a12 A G 3: 14,481,064 S90G possibly damaging Het
Specc1l A G 10: 75,246,576 D619G probably damaging Het
Src A G 2: 157,462,790 D143G probably benign Het
Sst T C 16: 23,889,808 N91S probably benign Het
Stxbp5l T A 16: 37,216,036 I406F probably damaging Het
Thsd1 T A 8: 22,258,871 I525N probably damaging Het
Ticam2 A T 18: 46,560,400 F207I probably damaging Het
Tsc22d1 C A 14: 76,418,740 N31K probably damaging Het
Tspan10 T C 11: 120,446,163 V253A probably benign Het
Ttc33 A G 15: 5,208,443 K99R possibly damaging Het
Vmn1r63 T A 7: 5,803,213 N140I probably damaging Het
Zbtb25 A G 12: 76,349,129 *440Q probably null Het
Zfhx4 T A 3: 5,396,918 C1218S probably damaging Het
Zfp84 T A 7: 29,777,182 I433N probably damaging Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R1958:Ptprb UTSW 10 116341536 missense probably benign 0.10
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
R7181:Ptprb UTSW 10 116368766 missense probably damaging 1.00
R7215:Ptprb UTSW 10 116338776 missense possibly damaging 0.94
R7289:Ptprb UTSW 10 116328165 missense probably damaging 0.99
R7315:Ptprb UTSW 10 116362379 missense possibly damaging 0.83
R7319:Ptprb UTSW 10 116341404 missense probably benign 0.01
R7381:Ptprb UTSW 10 116341133 missense probably benign
R7412:Ptprb UTSW 10 116341138 missense probably benign
R7483:Ptprb UTSW 10 116283429 missense probably benign 0.01
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGAAGGGGCTTTGTAAATCCTG -3'
(R):5'- TGGTGTGGAGAAACCTTCATG -3'

Sequencing Primer
(F):5'- GCTTTTGCTGGTCCACAATTATAG -3'
(R):5'- TGTGGAGAAACCTTCATGGACCAC -3'
Posted On2014-10-15