Incidental Mutation 'R1958:Ptprb'
ID218050
Institutional Source Beutler Lab
Gene Symbol Ptprb
Ensembl Gene ENSMUSG00000020154
Gene Nameprotein tyrosine phosphatase, receptor type, B
Synonyms3230402H02Rik, VE-PTP
MMRRC Submission 039972-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1958 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116275523-116389535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116341536 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1047 (T1047M)
Ref Sequence ENSEMBL: ENSMUSP00000089805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092167] [ENSMUST00000218553]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083152
Predicted Effect probably benign
Transcript: ENSMUST00000092167
AA Change: T1047M

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000089805
Gene: ENSMUSG00000020154
AA Change: T1047M

DomainStartEndE-ValueType
FN3 22 102 8.23e1 SMART
FN3 111 193 1.73e-5 SMART
FN3 204 281 1.56e-3 SMART
FN3 290 366 6.45e-5 SMART
FN3 378 459 5e-2 SMART
FN3 468 546 1.61e-5 SMART
FN3 555 632 7.18e-3 SMART
FN3 644 724 7.52e-6 SMART
FN3 732 811 2.92e-3 SMART
FN3 820 899 2.76e-4 SMART
FN3 908 987 1.29e-4 SMART
FN3 996 1075 7.7e-3 SMART
FN3 1086 1166 1.21e0 SMART
FN3 1174 1253 5.08e-3 SMART
FN3 1262 1340 1.17e-7 SMART
FN3 1356 1435 2.68e-2 SMART
Blast:FN3 1450 1591 6e-88 BLAST
transmembrane domain 1620 1642 N/A INTRINSIC
Blast:PTPc 1643 1681 3e-11 BLAST
PTPc 1703 1966 1.05e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218553
AA Change: T1334M

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency 97% (99/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and one intracytoplasmic catalytic domain, thus belongs to receptor type PTP. The extracellular region of this PTP is composed of multiple fibronectin type_III repeats, which was shown to interact with neuronal receptor and cell adhesion molecules, such as contactin and tenascin C. This protein was also found to interact with sodium channels, and thus may regulate sodium channels by altering tyrosine phosphorylation status. The functions of the interaction partners of this protein implicate the roles of this PTP in cell adhesion, neurite growth, and neuronal differentiation. Alternate transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E10, impaired vascular maintenace and remodeling, heart defects and abnormal yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,538,909 N155I probably benign Het
Abca14 A G 7: 120,325,159 Y1678C probably damaging Het
Adamts19 A T 18: 58,970,006 R706S probably benign Het
Adipor1 T C 1: 134,423,033 S7P probably benign Het
Adss A G 1: 177,769,978 I372T probably damaging Het
Arhgap15 T A 2: 44,243,124 D347E possibly damaging Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
Asb8 T C 15: 98,136,216 T153A possibly damaging Het
Aspscr1 G T 11: 120,689,208 G191V probably null Het
Atm T C 9: 53,471,418 H1957R probably damaging Het
Atp13a5 A G 16: 29,314,601 Y411H probably damaging Het
Cadm1 T G 9: 47,850,335 I411S probably damaging Het
Cdh23 T A 10: 60,410,873 M927L probably benign Het
Cdk15 A T 1: 59,344,316 R423W probably damaging Het
Cep250 T A 2: 155,976,381 probably null Het
Cfap43 T A 19: 47,897,210 Y322F probably benign Het
Cfap54 T C 10: 92,997,342 S1141G probably benign Het
Clnk T C 5: 38,706,626 Y428C possibly damaging Het
Cnksr1 A G 4: 134,228,416 S668P probably benign Het
Cpxm2 A T 7: 132,062,147 I349N probably damaging Het
Csmd3 A G 15: 48,004,639 probably null Het
Dnmt1 C T 9: 20,927,146 R207H probably benign Het
Dph2 A T 4: 117,891,844 F5I probably damaging Het
Dst T A 1: 34,163,721 F325L probably damaging Het
Edem3 T C 1: 151,804,325 L474S probably damaging Het
Emilin1 T A 5: 30,917,816 L467Q probably benign Het
Fam170a G A 18: 50,282,114 E276K probably benign Het
Farp1 A T 14: 121,219,375 probably null Het
Fbrs A T 7: 127,485,991 T584S possibly damaging Het
Fbxo22 T A 9: 55,209,342 probably null Het
Fhod3 T G 18: 25,090,465 L956R probably damaging Het
Fmo4 G A 1: 162,803,690 T236I probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Gdf10 G A 14: 33,932,753 A406T probably benign Het
Gm11444 A T 11: 85,848,173 probably benign Het
Gm14443 T C 2: 175,169,704 I316M probably benign Het
Gm4758 T C 16: 36,312,565 L68P possibly damaging Het
Has3 A T 8: 106,878,803 Y547F probably benign Het
Hdhd2 A G 18: 76,965,145 T164A probably benign Het
Hoxb9 T A 11: 96,272,054 D171E possibly damaging Het
Hpx A G 7: 105,596,396 Y118H probably damaging Het
Iqsec1 T C 6: 90,670,459 K858E probably damaging Het
Kifc1 G A 17: 33,884,711 R195C probably benign Het
Lama2 C A 10: 26,981,598 R3085L probably damaging Het
Lyst C A 13: 13,616,618 A22E probably damaging Het
Man2a1 T C 17: 64,750,835 F1079L probably benign Het
Marco C T 1: 120,484,864 G303R probably damaging Het
Marveld2 A C 13: 100,597,350 I536R probably damaging Het
Mcm5 A G 8: 75,121,629 D502G probably benign Het
Mdga1 A T 17: 29,840,888 L653Q probably damaging Het
Micalcl A G 7: 112,381,104 D161G probably benign Het
Mroh2a C T 1: 88,237,491 R445* probably null Het
Mrpl46 A T 7: 78,781,398 probably null Het
Nckipsd C A 9: 108,814,664 probably null Het
Nek11 T C 9: 105,293,717 D373G probably benign Het
Nle1 G A 11: 82,904,242 S321F probably benign Het
Noxa1 A G 2: 25,090,608 S130P probably damaging Het
Olfr1156 A T 2: 87,949,465 L256H probably damaging Het
Olfr620 T A 7: 103,611,411 *314L probably null Het
Olfr713 A G 7: 107,036,271 T39A possibly damaging Het
Olfr887 T A 9: 38,085,123 C96S probably damaging Het
Parp3 T G 9: 106,474,822 probably null Het
Pask A T 1: 93,321,458 I740N probably benign Het
Pelp1 A G 11: 70,398,521 F221S probably damaging Het
Pkd1l1 T G 11: 8,874,161 K1135Q probably benign Het
Plcl2 A T 17: 50,608,081 Q706L probably damaging Het
Psg26 T C 7: 18,478,339 T364A probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab37 C T 11: 115,160,351 A155V probably damaging Het
Rbbp6 A C 7: 123,001,945 probably benign Het
Rbmxl2 A G 7: 107,210,198 D230G probably benign Het
Rsf1 CGGCGGCGGCGGCGGCGGCGGCGGCGGC CGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,908 probably benign Het
Sass6 G T 3: 116,610,296 K194N possibly damaging Het
Sgpp1 T G 12: 75,735,448 D39A probably benign Het
Shank3 T C 15: 89,503,148 V198A probably damaging Het
Sin3a T A 9: 57,105,609 S591T probably damaging Het
Slc12a6 C T 2: 112,355,158 T924I possibly damaging Het
Sln T A 9: 53,853,501 I10N probably benign Het
St3gal3 A T 4: 117,940,071 M309K probably damaging Het
Syne2 T A 12: 75,969,545 D3301E probably benign Het
Tgtp2 A G 11: 49,059,092 S218P probably damaging Het
Tha1 C T 11: 117,869,353 probably benign Het
Tmem102 A G 11: 69,804,399 V249A probably benign Het
Top3b G A 16: 16,884,302 E268K possibly damaging Het
Trip4 T C 9: 65,839,025 S530G possibly damaging Het
Tut1 T A 19: 8,959,313 V167E probably damaging Het
Ube2u A T 4: 100,481,636 M33L probably benign Het
Unc79 T C 12: 102,991,362 I12T probably damaging Het
Unc79 A T 12: 103,074,919 D737V probably benign Het
Vmn1r26 A G 6: 58,008,301 V301A probably benign Het
Vmn1r86 A G 7: 13,102,694 V35A possibly damaging Het
Vmn2r98 A C 17: 19,066,418 N393H possibly damaging Het
Vps13b T G 15: 35,878,689 S2945A probably damaging Het
Whrn C T 4: 63,435,429 R367H possibly damaging Het
Zcchc11 A T 4: 108,555,706 S1535C probably damaging Het
Zfp235 A T 7: 24,140,346 L133F probably damaging Het
Zfp74 T C 7: 29,935,711 T191A probably benign Het
Zfp943 A T 17: 21,992,998 K355I probably damaging Het
Zranb1 T G 7: 132,982,729 S601R probably damaging Het
Zscan29 A T 2: 121,169,808 probably null Het
Other mutations in Ptprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Ptprb APN 10 116362648 missense probably benign 0.15
IGL01354:Ptprb APN 10 116343891 missense probably benign 0.24
IGL01404:Ptprb APN 10 116339436 missense probably benign 0.14
IGL01410:Ptprb APN 10 116302274 missense possibly damaging 0.60
IGL01412:Ptprb APN 10 116343915 missense probably benign 0.27
IGL01731:Ptprb APN 10 116372876 missense probably damaging 1.00
IGL02003:Ptprb APN 10 116367505 missense probably damaging 1.00
IGL02110:Ptprb APN 10 116331203 splice site probably benign
IGL02178:Ptprb APN 10 116322532 missense probably benign 0.00
IGL02304:Ptprb APN 10 116331259 missense probably damaging 1.00
IGL02324:Ptprb APN 10 116319333 missense probably benign 0.03
IGL02388:Ptprb APN 10 116367521 missense probably damaging 1.00
IGL02640:Ptprb APN 10 116338664 missense probably damaging 0.99
IGL02698:Ptprb APN 10 116363280 missense probably benign 0.05
IGL02876:Ptprb APN 10 116348211 splice site probably benign
IGL02879:Ptprb APN 10 116327968 missense probably benign
IGL02982:Ptprb APN 10 116322628 missense probably benign 0.20
IGL03146:Ptprb APN 10 116328127 missense probably benign 0.14
IGL03351:Ptprb APN 10 116339582 missense probably benign 0.03
R0306:Ptprb UTSW 10 116343988 missense probably benign 0.04
R0385:Ptprb UTSW 10 116350178 missense probably benign 0.00
R0600:Ptprb UTSW 10 116368807 missense possibly damaging 0.63
R0613:Ptprb UTSW 10 116302325 missense possibly damaging 0.59
R0613:Ptprb UTSW 10 116302378 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116302125 missense possibly damaging 0.87
R0850:Ptprb UTSW 10 116339510 missense probably damaging 1.00
R1331:Ptprb UTSW 10 116367532 missense probably damaging 1.00
R1413:Ptprb UTSW 10 116339679 missense probably damaging 1.00
R1418:Ptprb UTSW 10 116319470 missense probably benign 0.00
R1545:Ptprb UTSW 10 116380869 missense probably damaging 1.00
R1562:Ptprb UTSW 10 116339467 missense probably benign 0.00
R1752:Ptprb UTSW 10 116340990 missense probably benign 0.44
R1837:Ptprb UTSW 10 116341626 missense probably benign 0.00
R1940:Ptprb UTSW 10 116319610 splice site probably benign
R2029:Ptprb UTSW 10 116347053 missense probably benign 0.37
R2031:Ptprb UTSW 10 116317543 missense probably benign
R2101:Ptprb UTSW 10 116315038 splice site probably benign
R2209:Ptprb UTSW 10 116369357 missense probably damaging 1.00
R3016:Ptprb UTSW 10 116357295 missense possibly damaging 0.64
R3076:Ptprb UTSW 10 116344026 missense probably damaging 0.99
R3821:Ptprb UTSW 10 116350074 missense probably benign 0.11
R3824:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3825:Ptprb UTSW 10 116350789 missense probably benign 0.05
R3841:Ptprb UTSW 10 116346982 missense possibly damaging 0.79
R3953:Ptprb UTSW 10 116341494 missense probably benign 0.00
R4125:Ptprb UTSW 10 116353849 missense probably benign 0.12
R4227:Ptprb UTSW 10 116302225 missense possibly damaging 0.96
R4385:Ptprb UTSW 10 116346867 missense probably benign
R4731:Ptprb UTSW 10 116319333 missense probably benign 0.03
R5009:Ptprb UTSW 10 116348127 missense possibly damaging 0.61
R5104:Ptprb UTSW 10 116322459 missense probably benign 0.17
R5114:Ptprb UTSW 10 116348183 missense possibly damaging 0.59
R5145:Ptprb UTSW 10 116343915 missense probably benign 0.27
R5214:Ptprb UTSW 10 116369324 missense possibly damaging 0.75
R5382:Ptprb UTSW 10 116353871 missense probably damaging 1.00
R5553:Ptprb UTSW 10 116350185 missense probably damaging 1.00
R5585:Ptprb UTSW 10 116380854 missense probably damaging 0.98
R5586:Ptprb UTSW 10 116353827 missense probably damaging 1.00
R5808:Ptprb UTSW 10 116339487 missense probably benign 0.00
R5875:Ptprb UTSW 10 116348166 missense probably benign 0.00
R6051:Ptprb UTSW 10 116341090 nonsense probably null
R6383:Ptprb UTSW 10 116347007 nonsense probably null
R6511:Ptprb UTSW 10 116346820 missense probably damaging 1.00
R6817:Ptprb UTSW 10 116283677 small deletion probably benign
R6826:Ptprb UTSW 10 116317372 missense probably benign 0.26
R6958:Ptprb UTSW 10 116277248 missense probably benign 0.32
R7103:Ptprb UTSW 10 116338813 missense probably damaging 1.00
R7129:Ptprb UTSW 10 116283677 small deletion probably benign
X0020:Ptprb UTSW 10 116302180 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGTTTCTTTGAAGTCCCAGCG -3'
(R):5'- CCTTGTGTCAGTGTGAAGTCAG -3'

Sequencing Primer
(F):5'- TGAAGTCCCAGCGTCTGTC -3'
(R):5'- GACTACTGTGTCAAGAGCTATGC -3'
Posted On2014-08-01