Incidental Mutation 'R2288:Vnn3'
ID244183
Institutional Source Beutler Lab
Gene Symbol Vnn3
Ensembl Gene ENSMUSG00000020010
Gene Namevanin 3
Synonyms
MMRRC Submission 040287-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2288 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23851462-23869843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23864456 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 219 (D219G)
Ref Sequence ENSEMBL: ENSMUSP00000020190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020190]
Predicted Effect probably benign
Transcript: ENSMUST00000020190
AA Change: D219G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020190
Gene: ENSMUSG00000020010
AA Change: D219G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CN_hydrolase 51 296 6.9e-19 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf4 T C 17: 42,667,511 T314A probably benign Het
Ces2a T C 8: 104,737,437 S234P probably damaging Het
Cfh A T 1: 140,098,901 N571K possibly damaging Het
Clasp1 A G 1: 118,578,878 I940V probably benign Het
Dapk1 T C 13: 60,761,749 L1392S probably damaging Het
Fbxw19 T A 9: 109,493,568 L111F probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Nek10 G T 14: 14,853,956 E381* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr1033 T A 2: 86,042,033 C239* probably null Het
Peg3 T C 7: 6,709,115 E1036G probably damaging Het
Psma3 T G 12: 70,994,371 D173E possibly damaging Het
Ptpn14 T C 1: 189,865,498 L1135P probably damaging Het
Sfxn1 A G 13: 54,093,957 I234V probably benign Het
Tcf20 A G 15: 82,851,685 V1855A probably benign Het
Tctn3 A T 19: 40,605,713 C419S probably damaging Het
Tlr3 T A 8: 45,397,668 I207F probably damaging Het
Tmem246 A T 4: 49,586,445 L241Q probably damaging Het
Ubr1 T A 2: 120,909,482 R992S probably damaging Het
V1ra8 T C 6: 90,203,042 S76P probably damaging Het
Zfp536 T A 7: 37,480,348 D944V probably damaging Het
Zfp683 CGGG CCGGGGG 4: 134,056,070 probably benign Het
Other mutations in Vnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Vnn3 APN 10 23867168 missense possibly damaging 0.77
IGL01300:Vnn3 APN 10 23864365 missense possibly damaging 0.87
IGL01349:Vnn3 APN 10 23851916 missense probably damaging 0.99
IGL02491:Vnn3 APN 10 23865918 missense probably benign 0.11
IGL03256:Vnn3 APN 10 23851800 splice site probably benign
IGL03289:Vnn3 APN 10 23865837 missense possibly damaging 0.92
IGL02799:Vnn3 UTSW 10 23851971 missense possibly damaging 0.64
R0599:Vnn3 UTSW 10 23865705 missense possibly damaging 0.94
R1703:Vnn3 UTSW 10 23865930 missense probably benign
R1753:Vnn3 UTSW 10 23865820 missense probably benign 0.27
R2119:Vnn3 UTSW 10 23864413 missense probably damaging 1.00
R4255:Vnn3 UTSW 10 23865822 missense probably benign 0.18
R4458:Vnn3 UTSW 10 23865669 missense probably benign 0.23
R4518:Vnn3 UTSW 10 23867226 missense possibly damaging 0.77
R4545:Vnn3 UTSW 10 23856326 missense probably benign 0.00
R4723:Vnn3 UTSW 10 23851691 missense possibly damaging 0.88
R4791:Vnn3 UTSW 10 23864621 missense probably benign
R4921:Vnn3 UTSW 10 23864575 missense probably benign 0.01
R5152:Vnn3 UTSW 10 23864339 missense probably benign 0.01
R5390:Vnn3 UTSW 10 23851585 start codon destroyed probably null 1.00
R5545:Vnn3 UTSW 10 23867094 missense probably benign 0.00
R6197:Vnn3 UTSW 10 23856289 missense probably damaging 1.00
R6751:Vnn3 UTSW 10 23869625 missense probably benign 0.00
R6846:Vnn3 UTSW 10 23851722 missense probably benign
R6917:Vnn3 UTSW 10 23865934 missense possibly damaging 0.50
R7073:Vnn3 UTSW 10 23864413 missense probably damaging 1.00
R7100:Vnn3 UTSW 10 23865942 missense probably damaging 1.00
R7152:Vnn3 UTSW 10 23851615 missense possibly damaging 0.88
R7336:Vnn3 UTSW 10 23851908 missense probably benign 0.42
R7421:Vnn3 UTSW 10 23865768 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTCATGGAACCATATGCACTTC -3'
(R):5'- ACCTGTCATATGCATGCTGGTG -3'

Sequencing Primer
(F):5'- ACCATATGCACTTCAATATACATGG -3'
(R):5'- CATATGCATGCTGGTGTTGTG -3'
Posted On2014-10-30