Incidental Mutation 'R6751:Vnn3'
ID530784
Institutional Source Beutler Lab
Gene Symbol Vnn3
Ensembl Gene ENSMUSG00000020010
Gene Namevanin 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6751 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location23851462-23869843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 23869625 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 491 (R491C)
Ref Sequence ENSEMBL: ENSMUSP00000020190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020190]
Predicted Effect probably benign
Transcript: ENSMUST00000020190
AA Change: R491C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000020190
Gene: ENSMUSG00000020010
AA Change: R491C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CN_hydrolase 51 296 6.9e-19 PFAM
Meta Mutation Damage Score 0.012 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.7%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,210 N387Y probably damaging Het
4932415D10Rik A G 10: 82,283,497 S4560P probably benign Het
Abhd17a T C 10: 80,586,587 E87G probably damaging Het
Aco1 T A 4: 40,188,330 probably null Het
Adcy6 T C 15: 98,596,205 N817S probably benign Het
Ak8 T A 2: 28,709,945 L63* probably null Het
Arhgef28 G A 13: 98,075,247 S76L probably damaging Het
Asap1 A G 15: 64,094,412 L891S possibly damaging Het
Cacng5 C A 11: 107,877,553 M209I probably benign Het
Casr T C 16: 36,515,588 I120V probably benign Het
Chd7 T C 4: 8,833,866 Y1207H probably damaging Het
Chrnb2 A T 3: 89,761,576 F144Y probably damaging Het
Cyp4a14 T A 4: 115,491,194 H362L probably damaging Het
Dym G A 18: 75,286,647 V630M probably damaging Het
Dyrk1b C A 7: 28,186,709 P619Q probably damaging Het
Dyx1c1 A G 9: 72,961,975 T156A probably benign Het
Eml5 T C 12: 98,865,400 D433G probably damaging Het
Fam58b T C 11: 78,751,124 Y180C probably damaging Het
Frem2 A T 3: 53,653,665 S1140R probably damaging Het
Gabra5 T C 7: 57,418,334 R255G probably damaging Het
Galnt17 T A 5: 131,081,590 I304F probably damaging Het
Gpc5 A G 14: 115,369,951 S322G probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Hmcn1 T A 1: 150,734,518 N1467Y probably damaging Het
Ifna6 T C 4: 88,827,750 L112P probably damaging Het
Ifrd1 C T 12: 40,203,914 probably null Het
Il17f A G 1: 20,779,489 M17T probably benign Het
Itga11 G A 9: 62,768,584 V892I probably benign Het
Nckap5l A G 15: 99,423,161 L1246P probably damaging Het
Nlrp4f A T 13: 65,194,429 H467Q probably damaging Het
Ntng2 A G 2: 29,228,043 V131A possibly damaging Het
Olfr550 G A 7: 102,578,499 M1I probably null Het
Olfr889 T G 9: 38,115,975 Y60D probably damaging Het
Olfr970 T A 9: 39,819,897 V86E probably benign Het
Olfr972 T C 9: 39,873,680 V135A probably benign Het
Osbpl8 T C 10: 111,275,013 Y459H possibly damaging Het
Pabpc1 A T 15: 36,597,534 V537D possibly damaging Het
Pde4b A T 4: 102,602,671 M583L probably damaging Het
Phlda1 T C 10: 111,506,694 V97A possibly damaging Het
Pik3cb G T 9: 99,094,521 H174Q probably benign Het
Plxdc2 A T 2: 16,548,141 I117F probably benign Het
Psapl1 C A 5: 36,204,959 C298* probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Rtkn2 T A 10: 68,041,453 F448I probably benign Het
Scn10a T C 9: 119,671,551 R221G probably damaging Het
Serpina3c A G 12: 104,151,500 L193P probably damaging Het
Sox12 T C 2: 152,396,758 Y314C probably damaging Het
Sptbn1 T C 11: 30,117,859 E1772G probably damaging Het
Supt6 A G 11: 78,208,949 V1570A probably benign Het
Synrg T C 11: 83,981,425 F125S probably damaging Het
Tenm4 A T 7: 96,845,712 I1116F possibly damaging Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfap2d C A 1: 19,103,283 H10N possibly damaging Het
Trpm8 T C 1: 88,384,706 I1103T possibly damaging Het
Vmn1r158 C T 7: 22,789,881 C301Y probably damaging Het
Vmn2r56 T C 7: 12,694,792 I516V probably benign Het
Vmn2r71 G A 7: 85,619,887 probably null Het
Vps50 A G 6: 3,600,274 Y911C probably damaging Het
Wdr60 A T 12: 116,213,456 V842E possibly damaging Het
Zfp772 C T 7: 7,203,717 R325Q possibly damaging Het
Zranb3 T A 1: 127,959,819 H957L probably benign Het
Zscan20 G T 4: 128,585,875 T941K probably damaging Het
Zscan25 T A 5: 145,290,563 F346I probably damaging Het
Other mutations in Vnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Vnn3 APN 10 23867168 missense possibly damaging 0.77
IGL01300:Vnn3 APN 10 23864365 missense possibly damaging 0.87
IGL01349:Vnn3 APN 10 23851916 missense probably damaging 0.99
IGL02491:Vnn3 APN 10 23865918 missense probably benign 0.11
IGL03256:Vnn3 APN 10 23851800 splice site probably benign
IGL03289:Vnn3 APN 10 23865837 missense possibly damaging 0.92
IGL02799:Vnn3 UTSW 10 23851971 missense possibly damaging 0.64
R0599:Vnn3 UTSW 10 23865705 missense possibly damaging 0.94
R1703:Vnn3 UTSW 10 23865930 missense probably benign
R1753:Vnn3 UTSW 10 23865820 missense probably benign 0.27
R2119:Vnn3 UTSW 10 23864413 missense probably damaging 1.00
R2288:Vnn3 UTSW 10 23864456 missense probably benign 0.03
R4255:Vnn3 UTSW 10 23865822 missense probably benign 0.18
R4458:Vnn3 UTSW 10 23865669 missense probably benign 0.23
R4518:Vnn3 UTSW 10 23867226 missense possibly damaging 0.77
R4545:Vnn3 UTSW 10 23856326 missense probably benign 0.00
R4723:Vnn3 UTSW 10 23851691 missense possibly damaging 0.88
R4791:Vnn3 UTSW 10 23864621 missense probably benign
R4921:Vnn3 UTSW 10 23864575 missense probably benign 0.01
R5152:Vnn3 UTSW 10 23864339 missense probably benign 0.01
R5390:Vnn3 UTSW 10 23851585 start codon destroyed probably null 1.00
R5545:Vnn3 UTSW 10 23867094 missense probably benign 0.00
R6197:Vnn3 UTSW 10 23856289 missense probably damaging 1.00
R6846:Vnn3 UTSW 10 23851722 missense probably benign
R6917:Vnn3 UTSW 10 23865934 missense possibly damaging 0.50
R7073:Vnn3 UTSW 10 23864413 missense probably damaging 1.00
R7100:Vnn3 UTSW 10 23865942 missense probably damaging 1.00
R7152:Vnn3 UTSW 10 23851615 missense possibly damaging 0.88
R7336:Vnn3 UTSW 10 23851908 missense probably benign 0.42
R7421:Vnn3 UTSW 10 23865768 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTGTTCTGCCATCAAATCATG -3'
(R):5'- CAGCAGCTTACATCGTATCTCC -3'

Sequencing Primer
(F):5'- CTGGAACTCATTCTGTAGACCAGG -3'
(R):5'- GTATCTCCTAATGGAACCCTGCAG -3'
Posted On2018-08-01