Incidental Mutation 'R2300:Arhgap24'
ID245301
Institutional Source Beutler Lab
Gene Symbol Arhgap24
Ensembl Gene ENSMUSG00000057315
Gene NameRho GTPase activating protein 24
Synonyms0610025G21Rik
MMRRC Submission 040299-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2300 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location102481391-102897937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102860425 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 71 (I71V)
Ref Sequence ENSEMBL: ENSMUSP00000070048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070000] [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112852] [ENSMUST00000112853] [ENSMUST00000112854]
Predicted Effect probably damaging
Transcript: ENSMUST00000070000
AA Change: I71V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070048
Gene: ENSMUSG00000057315
AA Change: I71V

DomainStartEndE-ValueType
RhoGAP 58 234 7.04e-67 SMART
low complexity region 476 487 N/A INTRINSIC
low complexity region 520 539 N/A INTRINSIC
coiled coil region 558 638 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000073302
AA Change: I68V

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315
AA Change: I68V

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094559
AA Change: I161V

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315
AA Change: I161V

DomainStartEndE-ValueType
PH 18 125 5.35e-23 SMART
RhoGAP 148 324 7.04e-67 SMART
low complexity region 566 577 N/A INTRINSIC
low complexity region 610 629 N/A INTRINSIC
coiled coil region 648 728 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112852
AA Change: I68V

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108473
Gene: ENSMUSG00000057315
AA Change: I68V

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112853
AA Change: I68V

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108474
Gene: ENSMUSG00000057315
AA Change: I68V

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112854
AA Change: I68V

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315
AA Change: I68V

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130222
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 G T 8: 83,930,117 E355* probably null Het
Aldh6a1 G T 12: 84,439,529 T205N probably damaging Het
Arid2 A T 15: 96,402,006 E1800V probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cd53 T C 3: 106,763,256 T154A probably benign Het
Chd7 G A 4: 8,855,241 A2157T probably benign Het
Clca4b A T 3: 144,916,671 N544K probably benign Het
Cntrl A G 2: 35,127,513 E444G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Gabrr1 A G 4: 33,152,449 K130E probably benign Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Jag1 T C 2: 137,096,315 Y255C probably damaging Het
Kif11 A G 19: 37,411,539 T825A probably benign Het
Lama4 T A 10: 39,087,320 M1296K probably benign Het
Lrp1 G T 10: 127,556,915 C2760* probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Nolc1 CAG CAGAAG 19: 46,081,359 probably benign Het
Nolc1 CAG CAGTAG 19: 46,081,368 probably benign Het
Nop16 A G 13: 54,585,866 probably null Het
Olfr134 T A 17: 38,175,550 Y155* probably null Het
Olfr992 T C 2: 85,400,132 I134V probably benign Het
Ostf1 T C 19: 18,581,280 D213G probably damaging Het
Slc28a2 C T 2: 122,441,778 Q34* probably null Het
St18 A G 1: 6,855,402 D928G probably damaging Het
Stag1 T C 9: 100,712,500 V31A possibly damaging Het
Tcl1b1 G A 12: 105,164,524 A89T probably benign Het
Tsen54 A T 11: 115,822,078 S464C probably damaging Het
Ttn A G 2: 76,907,448 F4249S probably benign Het
Xdh A G 17: 73,891,265 F1209S probably damaging Het
Ylpm1 G A 12: 85,060,319 probably null Het
Other mutations in Arhgap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Arhgap24 APN 5 102860399 missense possibly damaging 0.94
IGL01483:Arhgap24 APN 5 102860377 missense possibly damaging 0.91
IGL02641:Arhgap24 APN 5 102892520 missense probably damaging 1.00
IGL03166:Arhgap24 APN 5 102875686 splice site probably benign
R0506:Arhgap24 UTSW 5 102875777 missense probably damaging 0.99
R0606:Arhgap24 UTSW 5 102897220 missense probably damaging 1.00
R1457:Arhgap24 UTSW 5 102664106 missense probably damaging 0.98
R1491:Arhgap24 UTSW 5 102860332 missense possibly damaging 0.47
R1707:Arhgap24 UTSW 5 102892087 missense probably benign 0.40
R2112:Arhgap24 UTSW 5 102892500 missense probably damaging 1.00
R2516:Arhgap24 UTSW 5 102891910 missense probably benign
R3803:Arhgap24 UTSW 5 102892442 missense probably damaging 0.98
R4257:Arhgap24 UTSW 5 102664117 missense probably benign 0.00
R4761:Arhgap24 UTSW 5 102664214 intron probably benign
R5045:Arhgap24 UTSW 5 102891877 missense possibly damaging 0.79
R5121:Arhgap24 UTSW 5 102841335 missense probably damaging 1.00
R5209:Arhgap24 UTSW 5 102892149 missense probably benign 0.12
R5667:Arhgap24 UTSW 5 102846171 critical splice donor site probably null
R5914:Arhgap24 UTSW 5 102552159 intron probably null
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6158:Arhgap24 UTSW 5 102892912 missense probably benign 0.12
R6410:Arhgap24 UTSW 5 102892151 missense probably benign 0.10
R6450:Arhgap24 UTSW 5 102897124 missense probably benign 0.01
R6520:Arhgap24 UTSW 5 102880793 missense probably benign 0.00
R6666:Arhgap24 UTSW 5 102552297 intron probably null
R7233:Arhgap24 UTSW 5 102878501 missense probably benign 0.03
R7311:Arhgap24 UTSW 5 102892685 missense probably damaging 1.00
R7460:Arhgap24 UTSW 5 102892346 missense probably benign 0.36
R7483:Arhgap24 UTSW 5 102841308 missense probably benign 0.13
R7515:Arhgap24 UTSW 5 102846016 intron probably benign
Predicted Primers PCR Primer
(F):5'- CCCGGGACCTTTACAATGAG -3'
(R):5'- GCATATCTACCACATCAGTCATCAG -3'

Sequencing Primer
(F):5'- TACAATGAGTTTGAAAAGAAAACAGC -3'
(R):5'- GTCATCAGACAGCCCACGG -3'
Posted On2014-10-30