Incidental Mutation 'R5209:Arhgap24'
ID403032
Institutional Source Beutler Lab
Gene Symbol Arhgap24
Ensembl Gene ENSMUSG00000057315
Gene NameRho GTPase activating protein 24
Synonyms0610025G21Rik
MMRRC Submission 042784-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5209 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location102481391-102897937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102892149 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 317 (D317E)
Ref Sequence ENSEMBL: ENSMUSP00000108475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070000] [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112852] [ENSMUST00000112853] [ENSMUST00000112854]
Predicted Effect probably benign
Transcript: ENSMUST00000070000
AA Change: D320E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000070048
Gene: ENSMUSG00000057315
AA Change: D320E

DomainStartEndE-ValueType
RhoGAP 58 234 7.04e-67 SMART
low complexity region 476 487 N/A INTRINSIC
low complexity region 520 539 N/A INTRINSIC
coiled coil region 558 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073302
AA Change: D317E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315
AA Change: D317E

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094559
AA Change: D410E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315
AA Change: D410E

DomainStartEndE-ValueType
PH 18 125 5.35e-23 SMART
RhoGAP 148 324 7.04e-67 SMART
low complexity region 566 577 N/A INTRINSIC
low complexity region 610 629 N/A INTRINSIC
coiled coil region 648 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112852
AA Change: D317E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108473
Gene: ENSMUSG00000057315
AA Change: D317E

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112853
AA Change: D317E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108474
Gene: ENSMUSG00000057315
AA Change: D317E

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112854
AA Change: D317E

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315
AA Change: D317E

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,818 T4453A possibly damaging Het
Abca14 T C 7: 120,232,907 V500A probably benign Het
Abcg4 A G 9: 44,275,375 Y491H probably damaging Het
Adgb C A 10: 10,398,937 V759L possibly damaging Het
Adprhl1 T A 8: 13,242,563 K243* probably null Het
Arhgef5 A T 6: 43,273,700 I462F probably benign Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Btbd18 A G 2: 84,668,099 T694A possibly damaging Het
Ces1d A T 8: 93,175,188 probably benign Het
Chmp2a C A 7: 13,032,674 V106F probably damaging Het
Cinp T C 12: 110,874,060 E219G probably benign Het
Col5a3 C T 9: 20,778,643 probably benign Het
Dnhd1 T G 7: 105,696,460 S2271A probably benign Het
Epg5 T A 18: 77,951,282 L376H probably damaging Het
Fam81a T C 9: 70,125,160 T17A probably benign Het
Fgd2 T A 17: 29,368,376 probably null Het
Gjc3 C T 5: 137,957,271 V251I probably benign Het
Gnaz T G 10: 74,991,991 F192V probably benign Het
Hmgcr T C 13: 96,666,512 probably benign Het
Mamdc4 G T 2: 25,566,923 A614E probably damaging Het
Mapk8ip2 A T 15: 89,459,287 Q713L probably damaging Het
Mettl1 T C 10: 127,045,334 V238A possibly damaging Het
Ms4a4c G A 19: 11,416,438 G74E probably damaging Het
Msh3 A G 13: 92,344,954 probably null Het
Mtmr14 T A 6: 113,253,775 Y113* probably null Het
Mylk T C 16: 34,922,625 L1169P possibly damaging Het
Npr3 A G 15: 11,848,603 V426A possibly damaging Het
Olfr105-ps T C 17: 37,382,830 S88P probably damaging Het
Olfr221 T C 14: 52,035,953 T53A probably benign Het
Olfr771 A C 10: 129,160,932 D17E possibly damaging Het
Olfr905 T A 9: 38,473,521 M258K possibly damaging Het
Pcdhb17 T C 18: 37,487,461 F768S probably damaging Het
Piezo2 T C 18: 63,032,929 N2077S probably damaging Het
Pkd1l2 G A 8: 117,056,442 P713L probably benign Het
Primpol T C 8: 46,590,260 T333A probably benign Het
Pth2r A T 1: 65,388,697 T510S probably benign Het
Ptprr A T 10: 116,162,609 E208V probably damaging Het
Rag1 T C 2: 101,644,215 Y194C probably benign Het
Reep5 A T 18: 34,357,240 probably null Het
Rexo5 T A 7: 119,834,299 Y493* probably null Het
Rgs9 T C 11: 109,239,594 probably null Het
Rps6ka1 A T 4: 133,865,818 V218D probably damaging Het
Satb1 A T 17: 51,809,207 M16K probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn14 A G 11: 83,279,633 F395S possibly damaging Het
Sptbn5 T A 2: 120,072,002 I82F probably benign Het
Stam T A 2: 14,146,347 I505K probably benign Het
Tesk2 G A 4: 116,724,698 probably benign Het
Trappc12 T C 12: 28,737,794 K430R probably benign Het
Trmo T C 4: 46,387,740 N34D probably damaging Het
Ubr2 C A 17: 46,968,424 C686F probably damaging Het
Vdac1 C T 11: 52,376,452 T60I probably damaging Het
Zfp652 G C 11: 95,763,665 R478P possibly damaging Het
Other mutations in Arhgap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Arhgap24 APN 5 102860399 missense possibly damaging 0.94
IGL01483:Arhgap24 APN 5 102860377 missense possibly damaging 0.91
IGL02641:Arhgap24 APN 5 102892520 missense probably damaging 1.00
IGL03166:Arhgap24 APN 5 102875686 splice site probably benign
R0506:Arhgap24 UTSW 5 102875777 missense probably damaging 0.99
R0606:Arhgap24 UTSW 5 102897220 missense probably damaging 1.00
R1457:Arhgap24 UTSW 5 102664106 missense probably damaging 0.98
R1491:Arhgap24 UTSW 5 102860332 missense possibly damaging 0.47
R1707:Arhgap24 UTSW 5 102892087 missense probably benign 0.40
R2112:Arhgap24 UTSW 5 102892500 missense probably damaging 1.00
R2300:Arhgap24 UTSW 5 102860425 missense probably damaging 1.00
R2516:Arhgap24 UTSW 5 102891910 missense probably benign
R3803:Arhgap24 UTSW 5 102892442 missense probably damaging 0.98
R4257:Arhgap24 UTSW 5 102664117 missense probably benign 0.00
R4761:Arhgap24 UTSW 5 102664214 intron probably benign
R5045:Arhgap24 UTSW 5 102891877 missense possibly damaging 0.79
R5121:Arhgap24 UTSW 5 102841335 missense probably damaging 1.00
R5667:Arhgap24 UTSW 5 102846171 critical splice donor site probably null
R5914:Arhgap24 UTSW 5 102552159 intron probably null
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6158:Arhgap24 UTSW 5 102892912 missense probably benign 0.12
R6410:Arhgap24 UTSW 5 102892151 missense probably benign 0.10
R6450:Arhgap24 UTSW 5 102897124 missense probably benign 0.01
R6520:Arhgap24 UTSW 5 102880793 missense probably benign 0.00
R6666:Arhgap24 UTSW 5 102552297 intron probably null
R7233:Arhgap24 UTSW 5 102878501 missense probably benign 0.03
R7311:Arhgap24 UTSW 5 102892685 missense probably damaging 1.00
R7460:Arhgap24 UTSW 5 102892346 missense probably benign 0.36
R7483:Arhgap24 UTSW 5 102841308 missense probably benign 0.13
R7515:Arhgap24 UTSW 5 102846016
Predicted Primers PCR Primer
(F):5'- CCATGGGTCAGTTGCAGAAC -3'
(R):5'- CAGAATACCCATGCGGACAGTG -3'

Sequencing Primer
(F):5'- TGGGTCAGTTGCAGAACAAAGAAAAC -3'
(R):5'- GAGTGCCCATTTTGGTACCAGAAC -3'
Posted On2016-07-22