Incidental Mutation 'R2408:Vwa3a'
ID248097
Institutional Source Beutler Lab
Gene Symbol Vwa3a
Ensembl Gene ENSMUSG00000030889
Gene Namevon Willebrand factor A domain containing 3A
SynonymsE030013G06Rik
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R2408 (G1)
Quality Score224
Status Validated
Chromosome7
Chromosomal Location120739318-120805742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120773294 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 302 (S302P)
Ref Sequence ENSEMBL: ENSMUSP00000132372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033180] [ENSMUST00000166668] [ENSMUST00000167213] [ENSMUST00000168600]
Predicted Effect probably benign
Transcript: ENSMUST00000033180
AA Change: S302P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033180
Gene: ENSMUSG00000030889
AA Change: S302P

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 6.3e-30 PFAM
Pfam:VWA_3 483 634 1.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166668
AA Change: S302P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129136
Gene: ENSMUSG00000030889
AA Change: S302P

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167213
AA Change: S302P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133029
Gene: ENSMUSG00000030889
AA Change: S302P

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168600
AA Change: S302P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132372
Gene: ENSMUSG00000030889
AA Change: S302P

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 8.3e-29 PFAM
Pfam:VWA_3 483 609 5.3e-17 PFAM
Meta Mutation Damage Score 0.1064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Vwa3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Vwa3a APN 7 120783974 missense probably benign 0.09
IGL01807:Vwa3a APN 7 120775506 splice site probably null
IGL02850:Vwa3a APN 7 120773292 missense probably benign 0.00
IGL03253:Vwa3a APN 7 120778869 missense probably benign 0.03
R0026:Vwa3a UTSW 7 120780211 missense probably damaging 1.00
R0114:Vwa3a UTSW 7 120775380 missense probably benign 0.06
R1145:Vwa3a UTSW 7 120793343 missense probably damaging 0.99
R1145:Vwa3a UTSW 7 120793343 missense probably damaging 0.99
R1306:Vwa3a UTSW 7 120800390 missense possibly damaging 0.49
R1355:Vwa3a UTSW 7 120784111 missense probably damaging 1.00
R1412:Vwa3a UTSW 7 120780154 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1584:Vwa3a UTSW 7 120768165 missense probably damaging 1.00
R1686:Vwa3a UTSW 7 120780148 missense probably damaging 1.00
R1710:Vwa3a UTSW 7 120804031 splice site probably null
R1717:Vwa3a UTSW 7 120793386 missense probably benign
R1834:Vwa3a UTSW 7 120790136 missense probably benign 0.06
R1912:Vwa3a UTSW 7 120795627 missense probably damaging 1.00
R1970:Vwa3a UTSW 7 120780171 missense probably damaging 1.00
R1978:Vwa3a UTSW 7 120758954 missense probably null 0.00
R2034:Vwa3a UTSW 7 120782645 nonsense probably null
R2059:Vwa3a UTSW 7 120758949 missense probably damaging 0.98
R2120:Vwa3a UTSW 7 120792418 missense probably benign
R3423:Vwa3a UTSW 7 120799111 missense probably damaging 1.00
R3744:Vwa3a UTSW 7 120752594 missense probably benign
R3816:Vwa3a UTSW 7 120800379 missense probably benign 0.29
R3849:Vwa3a UTSW 7 120762464 nonsense probably null
R3904:Vwa3a UTSW 7 120758876 missense probably benign
R4031:Vwa3a UTSW 7 120768232 critical splice donor site probably null
R4408:Vwa3a UTSW 7 120778926 missense probably benign 0.16
R4628:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4629:Vwa3a UTSW 7 120793375 missense probably benign 0.05
R4652:Vwa3a UTSW 7 120778915 missense probably damaging 0.96
R4884:Vwa3a UTSW 7 120791701 missense probably benign
R4948:Vwa3a UTSW 7 120776264 missense probably damaging 0.98
R5112:Vwa3a UTSW 7 120783985 missense probably damaging 1.00
R5385:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5386:Vwa3a UTSW 7 120790142 missense possibly damaging 0.91
R5579:Vwa3a UTSW 7 120768173 missense probably benign 0.29
R5587:Vwa3a UTSW 7 120780235 missense probably damaging 1.00
R5639:Vwa3a UTSW 7 120790143 missense probably damaging 0.99
R6102:Vwa3a UTSW 7 120776138 splice site probably null
R6239:Vwa3a UTSW 7 120794234 missense probably benign 0.00
R6279:Vwa3a UTSW 7 120782400 missense probably damaging 0.98
R6298:Vwa3a UTSW 7 120795651 missense probably benign 0.01
R6300:Vwa3a UTSW 7 120782400 missense probably damaging 0.98
R6336:Vwa3a UTSW 7 120762423 missense possibly damaging 0.93
R6907:Vwa3a UTSW 7 120792581 unclassified probably benign
V7732:Vwa3a UTSW 7 120778949 splice site probably benign
X0019:Vwa3a UTSW 7 120768209 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGTGTCTGAATCCCTCCC -3'
(R):5'- CTCTGCACACTTTCAGGGATC -3'

Sequencing Primer
(F):5'- TGTGGACTAGAACACACCTCTCG -3'
(R):5'- CTGCACACTTTCAGGGATCATATG -3'
Posted On2014-11-11