Incidental Mutation 'R2408:Sgms1'
ID248114
Institutional Source Beutler Lab
Gene Symbol Sgms1
Ensembl Gene ENSMUSG00000040451
Gene Namesphingomyelin synthase 1
SynonymsTmem23, SMS1gamma, SMS1alpha2, SMS1, SMS1beta, SMS1alpha1, 9530058O11Rik
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R2408 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location32122727-32389714 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 32159672 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 165 (R165*)
Ref Sequence ENSEMBL: ENSMUSP00000119869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099514] [ENSMUST00000134415] [ENSMUST00000142618] [ENSMUST00000151289] [ENSMUST00000151822] [ENSMUST00000152340]
Predicted Effect probably null
Transcript: ENSMUST00000099514
AA Change: R165*
SMART Domains Protein: ENSMUSP00000097114
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.3e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Pfam:PAP2 216 362 4.5e-10 PFAM
Pfam:PAP2_C 282 355 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131768
Predicted Effect probably null
Transcript: ENSMUST00000134415
AA Change: R165*
SMART Domains Protein: ENSMUSP00000115785
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 4.3e-7 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141655
Predicted Effect probably null
Transcript: ENSMUST00000142618
AA Change: R165*
SMART Domains Protein: ENSMUSP00000117336
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.3e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Pfam:PAP2 216 362 4.5e-10 PFAM
Pfam:PAP2_C 282 355 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149107
Predicted Effect probably null
Transcript: ENSMUST00000151289
AA Change: R165*
SMART Domains Protein: ENSMUSP00000123395
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.5e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
Pfam:PAP2_C 282 355 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151822
Predicted Effect probably null
Transcript: ENSMUST00000152340
AA Change: R165*
SMART Domains Protein: ENSMUSP00000119869
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 4.7e-7 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Meta Mutation Damage Score 0.574 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to be a five-pass transmembrane protein. This gene may be predominately expressed in brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, impaired insulin tolerance, increased insulin sensitivity, decreased insulin secretion, and abnormal pancreatic islet cell mitochondria morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Sgms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Sgms1 APN 19 32159625 missense probably damaging 1.00
IGL01585:Sgms1 APN 19 32142845 missense probably damaging 1.00
IGL02490:Sgms1 APN 19 32160143 missense probably damaging 0.98
IGL02970:Sgms1 APN 19 32159765 missense probably damaging 0.99
R1051:Sgms1 UTSW 19 32160039 missense probably damaging 1.00
R1871:Sgms1 UTSW 19 32159882 missense probably benign 0.01
R1971:Sgms1 UTSW 19 32159957 missense probably benign 0.05
R2001:Sgms1 UTSW 19 32159683 missense possibly damaging 0.94
R2404:Sgms1 UTSW 19 32159672 nonsense probably null
R2405:Sgms1 UTSW 19 32159672 nonsense probably null
R2410:Sgms1 UTSW 19 32159672 nonsense probably null
R3747:Sgms1 UTSW 19 32159594 missense possibly damaging 0.65
R4016:Sgms1 UTSW 19 32142792 missense possibly damaging 0.88
R4710:Sgms1 UTSW 19 32160137 missense probably damaging 1.00
R5056:Sgms1 UTSW 19 32159687 missense probably damaging 1.00
R5422:Sgms1 UTSW 19 32159832 missense probably damaging 0.98
R6023:Sgms1 UTSW 19 32124373 missense probably benign 0.12
R6106:Sgms1 UTSW 19 32124425 missense possibly damaging 0.87
R6932:Sgms1 UTSW 19 32142793 missense probably benign 0.02
R7207:Sgms1 UTSW 19 32142747 missense probably null 1.00
R7382:Sgms1 UTSW 19 32159782 missense possibly damaging 0.68
R7494:Sgms1 UTSW 19 32129691 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCCCTTCATGGCTGGATC -3'
(R):5'- TGACATTCCCAACCCCGATG -3'

Sequencing Primer
(F):5'- CCTTCATGGCTGGATCTCAAGAG -3'
(R):5'- TGGCAGCTTCAGCATCAAG -3'
Posted On2014-11-11