Incidental Mutation 'R2405:Sgms1'
ID247989
Institutional Source Beutler Lab
Gene Symbol Sgms1
Ensembl Gene ENSMUSG00000040451
Gene Namesphingomyelin synthase 1
SynonymsTmem23, SMS1gamma, SMS1alpha2, SMS1, SMS1beta, SMS1alpha1, 9530058O11Rik
MMRRC Submission 040371-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.848) question?
Stock #R2405 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location32122727-32389714 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 32159672 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 165 (R165*)
Ref Sequence ENSEMBL: ENSMUSP00000119869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099514] [ENSMUST00000134415] [ENSMUST00000142618] [ENSMUST00000151289] [ENSMUST00000151822] [ENSMUST00000152340]
Predicted Effect probably null
Transcript: ENSMUST00000099514
AA Change: R165*
SMART Domains Protein: ENSMUSP00000097114
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.3e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Pfam:PAP2 216 362 4.5e-10 PFAM
Pfam:PAP2_C 282 355 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131768
Predicted Effect probably null
Transcript: ENSMUST00000134415
AA Change: R165*
SMART Domains Protein: ENSMUSP00000115785
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 4.3e-7 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141655
Predicted Effect probably null
Transcript: ENSMUST00000142618
AA Change: R165*
SMART Domains Protein: ENSMUSP00000117336
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.3e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Pfam:PAP2 216 362 4.5e-10 PFAM
Pfam:PAP2_C 282 355 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149107
Predicted Effect probably null
Transcript: ENSMUST00000151289
AA Change: R165*
SMART Domains Protein: ENSMUSP00000123395
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.5e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
Pfam:PAP2_C 282 355 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151822
Predicted Effect probably null
Transcript: ENSMUST00000152340
AA Change: R165*
SMART Domains Protein: ENSMUSP00000119869
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 4.7e-7 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Meta Mutation Damage Score 0.574 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to be a five-pass transmembrane protein. This gene may be predominately expressed in brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, impaired insulin tolerance, increased insulin sensitivity, decreased insulin secretion, and abnormal pancreatic islet cell mitochondria morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Abl1 T C 2: 31,800,974 L835P possibly damaging Het
Ascc3 T A 10: 50,731,678 V1426D probably damaging Het
Ccny A G 18: 9,353,480 Y98H probably benign Het
Ccser2 G A 14: 36,938,669 T509M probably damaging Het
Crnkl1 A T 2: 145,928,157 Y255* probably null Het
Cyp2d11 C T 15: 82,389,266 S468N possibly damaging Het
Dnah7b C A 1: 46,362,954 T3983N probably benign Het
Ebf1 T A 11: 44,991,522 M427K probably damaging Het
Fxr1 T A 3: 34,061,854 S438T probably damaging Het
Gabrr1 A T 4: 33,157,110 D209V probably damaging Het
Gbx2 G T 1: 89,930,908 probably benign Het
Gm5741 A G 8: 85,067,641 I56T possibly damaging Het
Gm884 T C 11: 103,620,984 M53V unknown Het
Gulo A G 14: 65,991,028 probably null Het
Hhla1 A T 15: 65,936,311 L295* probably null Het
Hmcn1 T A 1: 150,860,341 I126L probably damaging Het
Hpse A G 5: 100,708,771 S121P possibly damaging Het
Inpp5d A G 1: 87,699,729 H321R possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm5b T A 1: 134,609,016 M658K probably damaging Het
Kidins220 A T 12: 25,011,509 E875V probably damaging Het
Nlrp4b A G 7: 10,714,728 E286G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pde3a A T 6: 141,481,242 I710F probably damaging Het
Phb T C 11: 95,675,268 I126T probably benign Het
Ppp4r1 C T 17: 65,811,346 T164I possibly damaging Het
Psmc1 G A 12: 100,120,103 R333Q probably benign Het
Pygb A G 2: 150,820,775 Y554C probably benign Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Serpina3a A T 12: 104,121,318 M357L possibly damaging Het
Serpinb9e T A 13: 33,260,080 M361K probably benign Het
Slc15a2 G A 16: 36,751,837 Q691* probably null Het
Slc25a25 C T 2: 32,417,719 probably null Het
Slc34a2 A G 5: 53,058,181 N9S probably benign Het
Slc4a2 A G 5: 24,435,601 T665A probably damaging Het
Spef2 C A 15: 9,626,034 E1149* probably null Het
Tmem179 A G 12: 112,501,913 W45R probably damaging Het
Tmpo C A 10: 91,163,354 K190N probably damaging Het
Triml1 T C 8: 43,130,283 Y427C probably damaging Het
Trpm2 A G 10: 77,934,724 L720P probably damaging Het
Vmn1r60 A G 7: 5,544,913 Y63H probably benign Het
Vmn2r96 T A 17: 18,597,840 C560S probably damaging Het
Zdhhc13 A G 7: 48,822,730 probably null Het
Other mutations in Sgms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Sgms1 APN 19 32159625 missense probably damaging 1.00
IGL01585:Sgms1 APN 19 32142845 missense probably damaging 1.00
IGL02490:Sgms1 APN 19 32160143 missense probably damaging 0.98
IGL02970:Sgms1 APN 19 32159765 missense probably damaging 0.99
R1051:Sgms1 UTSW 19 32160039 missense probably damaging 1.00
R1871:Sgms1 UTSW 19 32159882 missense probably benign 0.01
R1971:Sgms1 UTSW 19 32159957 missense probably benign 0.05
R2001:Sgms1 UTSW 19 32159683 missense possibly damaging 0.94
R2404:Sgms1 UTSW 19 32159672 nonsense probably null
R2408:Sgms1 UTSW 19 32159672 nonsense probably null
R2410:Sgms1 UTSW 19 32159672 nonsense probably null
R3747:Sgms1 UTSW 19 32159594 missense possibly damaging 0.65
R4016:Sgms1 UTSW 19 32142792 missense possibly damaging 0.88
R4710:Sgms1 UTSW 19 32160137 missense probably damaging 1.00
R5056:Sgms1 UTSW 19 32159687 missense probably damaging 1.00
R5422:Sgms1 UTSW 19 32159832 missense probably damaging 0.98
R6023:Sgms1 UTSW 19 32124373 missense probably benign 0.12
R6106:Sgms1 UTSW 19 32124425 missense possibly damaging 0.87
R6932:Sgms1 UTSW 19 32142793 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACTGGATCCCTGTGTGCAAAC -3'
(R):5'- GGCAGCTTCAGCATCAAGAC -3'

Sequencing Primer
(F):5'- CCTTCATGGCTGGATCTCAAGAG -3'
(R):5'- GGCAGCTTCAGCATCAAGACTAAAC -3'
Posted On2014-11-11