Incidental Mutation 'R2380:Lgr4'
ID248412
Institutional Source Beutler Lab
Gene Symbol Lgr4
Ensembl Gene ENSMUSG00000050199
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 4
SynonymsA930009A08Rik, Gpr48, A330106J01Rik
MMRRC Submission 040356-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2380 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location109917647-110014257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110012393 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 908 (Y908H)
Ref Sequence ENSEMBL: ENSMUSP00000047325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046548] [ENSMUST00000111037]
Predicted Effect probably damaging
Transcript: ENSMUST00000046548
AA Change: Y908H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047325
Gene: ENSMUSG00000050199
AA Change: Y908H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 1.49e1 SMART
LRR 80 103 1.99e0 SMART
LRR_TYP 104 127 2.75e-3 SMART
LRR_TYP 128 151 2.79e-4 SMART
LRR 152 175 2.54e1 SMART
LRR 176 199 4.65e-1 SMART
LRR_TYP 200 223 1.04e-3 SMART
LRR 224 246 6.4e0 SMART
LRR_TYP 247 270 5.99e-4 SMART
LRR 272 294 9.77e1 SMART
LRR 318 341 3e1 SMART
LRR 343 363 4.71e1 SMART
LRR 364 387 1.49e1 SMART
LRR_TYP 388 411 1.15e-5 SMART
LRR 412 435 3.98e1 SMART
low complexity region 500 516 N/A INTRINSIC
Pfam:7tm_1 555 801 2.7e-10 PFAM
low complexity region 824 837 N/A INTRINSIC
low complexity region 910 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111037
AA Change: Y884H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106666
Gene: ENSMUSG00000050199
AA Change: Y884H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 9.77e1 SMART
LRR_TYP 80 103 2.75e-3 SMART
LRR_TYP 104 127 2.79e-4 SMART
LRR 128 151 2.54e1 SMART
LRR 152 175 4.65e-1 SMART
LRR_TYP 176 199 1.04e-3 SMART
LRR 200 222 6.4e0 SMART
LRR_TYP 223 246 5.99e-4 SMART
LRR 248 270 9.77e1 SMART
LRR 294 317 3e1 SMART
LRR 319 339 4.71e1 SMART
LRR 340 363 1.49e1 SMART
LRR_TYP 364 387 1.15e-5 SMART
LRR 388 411 3.98e1 SMART
low complexity region 476 492 N/A INTRINSIC
Pfam:7tm_1 531 777 9.3e-17 PFAM
low complexity region 800 813 N/A INTRINSIC
low complexity region 886 900 N/A INTRINSIC
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor that binds R-spondins and activates the Wnt signaling pathway. This Wnt signaling pathway activation is necessary for proper development of many organs of the body. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a knock-out allele show embryonic and perinatal death, open eyelids, and abnormal renal development. One gene trap mutation leads to reduced body weight, sterility, and impaired male reproductive tract development. Another gene trap mutation causes ocular anterior segment anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 82,064,835 S978P possibly damaging Het
Ago3 G A 4: 126,368,522 R412C probably damaging Het
Ampd3 C T 7: 110,800,710 T344M probably damaging Het
Arl10 G T 13: 54,575,149 V19L probably benign Het
Aspm C T 1: 139,479,348 A1991V probably damaging Het
Axdnd1 A T 1: 156,365,651 D655E probably benign Het
Bdp1 T C 13: 100,060,370 H1169R probably benign Het
Cacna1s T C 1: 136,095,848 F942L probably damaging Het
Camk2g A G 14: 20,739,387 I205T probably damaging Het
Cdh5 C A 8: 104,125,672 H140N possibly damaging Het
Cog8 C A 8: 107,056,361 G99W probably damaging Het
Csmd1 A G 8: 16,190,087 C1104R probably damaging Het
Dhrs7c G A 11: 67,815,864 V283M probably benign Het
Emilin2 T A 17: 71,310,224 Q64L probably benign Het
Enpp3 T C 10: 24,776,872 E729G probably benign Het
Fam169a T A 13: 97,118,535 probably benign Het
Gm7714 T G 5: 88,282,554 M103R probably benign Het
Gm8979 T C 7: 106,082,167 E627G possibly damaging Het
Hmcn1 T A 1: 150,565,384 M5374L probably benign Het
Hsd17b1 A T 11: 101,078,463 I8F probably damaging Het
Itgae A G 11: 73,145,569 E1111G probably benign Het
Kcmf1 A G 6: 72,858,772 probably null Het
Kdm1b T A 13: 47,073,755 F574L probably damaging Het
Lig1 T C 7: 13,303,796 probably benign Het
Ltbp3 C A 19: 5,751,523 C698* probably null Het
Ncor2 A G 5: 125,036,080 V1216A possibly damaging Het
Olfr1156 T C 2: 87,949,397 T279A probably damaging Het
Olfr1463 T C 19: 13,234,721 V157A probably benign Het
Olfr594 A T 7: 103,220,608 T297S possibly damaging Het
Pmepa1 G A 2: 173,228,133 R210W probably damaging Het
Ppp5c A G 7: 17,006,115 Y434H probably damaging Het
Pwwp2b A G 7: 139,255,450 E269G probably damaging Het
Rgs3 A T 4: 62,625,887 T299S probably benign Het
Skint5 G A 4: 113,546,536 T1163I unknown Het
Slc35f4 A G 14: 49,306,203 probably null Het
Trmt5 A G 12: 73,285,114 I4T probably benign Het
Ttc7b A G 12: 100,355,001 probably null Het
Utp6 A G 11: 79,936,005 S582P possibly damaging Het
Zbtb41 T C 1: 139,423,814 S222P probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Lgr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Lgr4 APN 2 110011290 missense probably damaging 1.00
IGL02247:Lgr4 APN 2 110002501 missense probably benign
IGL02247:Lgr4 APN 2 110008075 splice site probably benign
IGL02302:Lgr4 APN 2 110002496 missense probably damaging 0.99
IGL02309:Lgr4 APN 2 110012535 utr 3 prime probably benign
IGL02511:Lgr4 APN 2 110011272 missense probably benign 0.06
IGL02604:Lgr4 APN 2 110011313 missense probably damaging 1.00
IGL02648:Lgr4 APN 2 110012373 missense probably damaging 1.00
IGL02795:Lgr4 APN 2 110008210 splice site probably benign
IGL02899:Lgr4 APN 2 109918253 missense probably damaging 0.99
R0003:Lgr4 UTSW 2 109997665 critical splice donor site probably null
R0200:Lgr4 UTSW 2 109970690 critical splice acceptor site probably null
R0314:Lgr4 UTSW 2 109991093 splice site probably benign
R0482:Lgr4 UTSW 2 110008092 missense probably damaging 1.00
R0491:Lgr4 UTSW 2 110007281 splice site probably benign
R0517:Lgr4 UTSW 2 110011320 missense probably damaging 1.00
R0546:Lgr4 UTSW 2 109999421 missense probably damaging 0.98
R0658:Lgr4 UTSW 2 110011787 missense possibly damaging 0.83
R1367:Lgr4 UTSW 2 109991135 missense probably damaging 0.98
R1864:Lgr4 UTSW 2 110011397 missense possibly damaging 0.93
R1977:Lgr4 UTSW 2 110011928 missense probably damaging 1.00
R2239:Lgr4 UTSW 2 110012393 missense probably damaging 1.00
R2383:Lgr4 UTSW 2 110000615 missense probably damaging 1.00
R2997:Lgr4 UTSW 2 110003517 missense probably benign 0.30
R3707:Lgr4 UTSW 2 109970754 missense probably damaging 0.99
R3803:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R3804:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R3843:Lgr4 UTSW 2 109996773 splice site probably benign
R4030:Lgr4 UTSW 2 109989751 missense probably benign 0.06
R4513:Lgr4 UTSW 2 110012016 missense possibly damaging 0.93
R4777:Lgr4 UTSW 2 109996682 missense probably damaging 0.98
R4912:Lgr4 UTSW 2 110006502 critical splice acceptor site probably null
R4994:Lgr4 UTSW 2 110011938 missense probably damaging 0.99
R5106:Lgr4 UTSW 2 109997595 missense probably damaging 0.97
R5131:Lgr4 UTSW 2 110012333 missense probably benign
R5152:Lgr4 UTSW 2 110000603 missense probably damaging 1.00
R5753:Lgr4 UTSW 2 110002512 nonsense probably null
R5860:Lgr4 UTSW 2 109991151 missense probably damaging 0.96
R5914:Lgr4 UTSW 2 109918272 missense possibly damaging 0.78
R6145:Lgr4 UTSW 2 110007243 nonsense probably null
R6263:Lgr4 UTSW 2 110011898 missense possibly damaging 0.95
R6400:Lgr4 UTSW 2 109991133 missense probably damaging 0.98
X0053:Lgr4 UTSW 2 110011437 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ATTCCCACTTGCAGGGTAAC -3'
(R):5'- AAGTCCTTCCCAGATGAAAGGTC -3'

Sequencing Primer
(F):5'- AACCTGACTGTCTGTGACTG -3'
(R):5'- GTCCTTCCCAGATGAAAGGTCAAAAG -3'
Posted On2014-11-11