Incidental Mutation 'R1367:Lgr4'
ID156060
Institutional Source Beutler Lab
Gene Symbol Lgr4
Ensembl Gene ENSMUSG00000050199
Gene Nameleucine-rich repeat-containing G protein-coupled receptor 4
SynonymsA930009A08Rik, Gpr48, A330106J01Rik
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location109917647-110014257 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 109991135 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 121 (P121A)
Ref Sequence ENSEMBL: ENSMUSP00000047325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046548] [ENSMUST00000111037]
Predicted Effect probably damaging
Transcript: ENSMUST00000046548
AA Change: P121A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047325
Gene: ENSMUSG00000050199
AA Change: P121A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 1.49e1 SMART
LRR 80 103 1.99e0 SMART
LRR_TYP 104 127 2.75e-3 SMART
LRR_TYP 128 151 2.79e-4 SMART
LRR 152 175 2.54e1 SMART
LRR 176 199 4.65e-1 SMART
LRR_TYP 200 223 1.04e-3 SMART
LRR 224 246 6.4e0 SMART
LRR_TYP 247 270 5.99e-4 SMART
LRR 272 294 9.77e1 SMART
LRR 318 341 3e1 SMART
LRR 343 363 4.71e1 SMART
LRR 364 387 1.49e1 SMART
LRR_TYP 388 411 1.15e-5 SMART
LRR 412 435 3.98e1 SMART
low complexity region 500 516 N/A INTRINSIC
Pfam:7tm_1 555 801 2.7e-10 PFAM
low complexity region 824 837 N/A INTRINSIC
low complexity region 910 924 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111037
AA Change: P97A

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106666
Gene: ENSMUSG00000050199
AA Change: P97A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 28 61 6.68e-6 SMART
LRR 55 79 9.77e1 SMART
LRR_TYP 80 103 2.75e-3 SMART
LRR_TYP 104 127 2.79e-4 SMART
LRR 128 151 2.54e1 SMART
LRR 152 175 4.65e-1 SMART
LRR_TYP 176 199 1.04e-3 SMART
LRR 200 222 6.4e0 SMART
LRR_TYP 223 246 5.99e-4 SMART
LRR 248 270 9.77e1 SMART
LRR 294 317 3e1 SMART
LRR 319 339 4.71e1 SMART
LRR 340 363 1.49e1 SMART
LRR_TYP 364 387 1.15e-5 SMART
LRR 388 411 3.98e1 SMART
low complexity region 476 492 N/A INTRINSIC
Pfam:7tm_1 531 777 9.3e-17 PFAM
low complexity region 800 813 N/A INTRINSIC
low complexity region 886 900 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152584
Meta Mutation Damage Score 0.326 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor that binds R-spondins and activates the Wnt signaling pathway. This Wnt signaling pathway activation is necessary for proper development of many organs of the body. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a knock-out allele show embryonic and perinatal death, open eyelids, and abnormal renal development. One gene trap mutation leads to reduced body weight, sterility, and impaired male reproductive tract development. Another gene trap mutation causes ocular anterior segment anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Lgr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Lgr4 APN 2 110011290 missense probably damaging 1.00
IGL02247:Lgr4 APN 2 110002501 missense probably benign
IGL02247:Lgr4 APN 2 110008075 splice site probably benign
IGL02302:Lgr4 APN 2 110002496 missense probably damaging 0.99
IGL02309:Lgr4 APN 2 110012535 utr 3 prime probably benign
IGL02511:Lgr4 APN 2 110011272 missense probably benign 0.06
IGL02604:Lgr4 APN 2 110011313 missense probably damaging 1.00
IGL02648:Lgr4 APN 2 110012373 missense probably damaging 1.00
IGL02795:Lgr4 APN 2 110008210 splice site probably benign
IGL02899:Lgr4 APN 2 109918253 missense probably damaging 0.99
R0003:Lgr4 UTSW 2 109997665 critical splice donor site probably null
R0200:Lgr4 UTSW 2 109970690 critical splice acceptor site probably null
R0314:Lgr4 UTSW 2 109991093 splice site probably benign
R0482:Lgr4 UTSW 2 110008092 missense probably damaging 1.00
R0491:Lgr4 UTSW 2 110007281 splice site probably benign
R0517:Lgr4 UTSW 2 110011320 missense probably damaging 1.00
R0546:Lgr4 UTSW 2 109999421 missense probably damaging 0.98
R0658:Lgr4 UTSW 2 110011787 missense possibly damaging 0.83
R1864:Lgr4 UTSW 2 110011397 missense possibly damaging 0.93
R1977:Lgr4 UTSW 2 110011928 missense probably damaging 1.00
R2239:Lgr4 UTSW 2 110012393 missense probably damaging 1.00
R2380:Lgr4 UTSW 2 110012393 missense probably damaging 1.00
R2383:Lgr4 UTSW 2 110000615 missense probably damaging 1.00
R2997:Lgr4 UTSW 2 110003517 missense probably benign 0.30
R3707:Lgr4 UTSW 2 109970754 missense probably damaging 0.99
R3803:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R3804:Lgr4 UTSW 2 110008197 missense probably benign 0.10
R3843:Lgr4 UTSW 2 109996773 splice site probably benign
R4030:Lgr4 UTSW 2 109989751 missense probably benign 0.06
R4513:Lgr4 UTSW 2 110012016 missense possibly damaging 0.93
R4777:Lgr4 UTSW 2 109996682 missense probably damaging 0.98
R4912:Lgr4 UTSW 2 110006502 critical splice acceptor site probably null
R4994:Lgr4 UTSW 2 110011938 missense probably damaging 0.99
R5106:Lgr4 UTSW 2 109997595 missense probably damaging 0.97
R5131:Lgr4 UTSW 2 110012333 missense probably benign
R5152:Lgr4 UTSW 2 110000603 missense probably damaging 1.00
R5753:Lgr4 UTSW 2 110002512 nonsense probably null
R5860:Lgr4 UTSW 2 109991151 missense probably damaging 0.96
R5914:Lgr4 UTSW 2 109918272 missense possibly damaging 0.78
R6145:Lgr4 UTSW 2 110007243 nonsense probably null
R6263:Lgr4 UTSW 2 110011898 missense possibly damaging 0.95
R6400:Lgr4 UTSW 2 109991133 missense probably damaging 0.98
X0053:Lgr4 UTSW 2 110011437 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CGCAGCCTAGTGAATCTTAGCTCG -3'
(R):5'- CCCCATTTTCATGCCAGGGAAGAG -3'

Sequencing Primer
(F):5'- TGGCCTGGAATAGCATCATC -3'
(R):5'- GGATAAATCTCCTAAATCTGCTCGG -3'
Posted On2014-02-11