Incidental Mutation 'R2937:Cbarp'
ID255080
Institutional Source Beutler Lab
Gene Symbol Cbarp
Ensembl Gene ENSMUSG00000035640
Gene Namecalcium channel, voltage-dependent, beta subunit associated regulatory protein
SynonymsR29144/1, Dos
MMRRC Submission 040514-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2937 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80130451-80140835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80131769 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 539 (D539G)
Ref Sequence ENSEMBL: ENSMUSP00000131487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003152] [ENSMUST00000105369] [ENSMUST00000105370] [ENSMUST00000105371] [ENSMUST00000123967] [ENSMUST00000132523] [ENSMUST00000144883] [ENSMUST00000147778] [ENSMUST00000152592] [ENSMUST00000169546] [ENSMUST00000170219] [ENSMUST00000213772]
Predicted Effect probably benign
Transcript: ENSMUST00000003152
SMART Domains Protein: ENSMUSP00000003152
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105369
AA Change: D539G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101008
Gene: ENSMUSG00000035640
AA Change: D539G

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105370
SMART Domains Protein: ENSMUSP00000101009
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 180 2.8e-22 PFAM
Pfam:Pkinase 1 183 2.8e-40 PFAM
Pfam:Kinase-like 8 171 5.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105371
Predicted Effect probably benign
Transcript: ENSMUST00000123967
SMART Domains Protein: ENSMUSP00000125962
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132317
Predicted Effect probably benign
Transcript: ENSMUST00000132523
SMART Domains Protein: ENSMUSP00000128980
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144119
Predicted Effect probably benign
Transcript: ENSMUST00000144883
SMART Domains Protein: ENSMUSP00000114195
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
S_TKc 49 309 1.28e-80 SMART
low complexity region 396 411 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146180
Predicted Effect probably benign
Transcript: ENSMUST00000147778
SMART Domains Protein: ENSMUSP00000130389
Gene: ENSMUSG00000035640

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 43 65 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149242
Predicted Effect probably benign
Transcript: ENSMUST00000152592
SMART Domains Protein: ENSMUSP00000118853
Gene: ENSMUSG00000003068

DomainStartEndE-ValueType
Blast:S_TKc 1 53 6e-31 BLAST
PDB:2WTK|F 1 74 1e-40 PDB
SCOP:d1koba_ 1 89 1e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169546
AA Change: D546G

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132978
Gene: ENSMUSG00000035640
AA Change: D546G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 192 204 N/A INTRINSIC
low complexity region 276 284 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 451 491 N/A INTRINSIC
low complexity region 522 541 N/A INTRINSIC
low complexity region 566 580 N/A INTRINSIC
low complexity region 634 658 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170219
AA Change: D539G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131487
Gene: ENSMUSG00000035640
AA Change: D539G

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
transmembrane domain 41 63 N/A INTRINSIC
low complexity region 185 197 N/A INTRINSIC
low complexity region 269 277 N/A INTRINSIC
low complexity region 380 388 N/A INTRINSIC
low complexity region 402 420 N/A INTRINSIC
low complexity region 444 484 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 627 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213772
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,659,127 E481G probably damaging Het
Anks1b C T 10: 90,077,066 T351M probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Asph A C 4: 9,542,314 probably benign Het
Bace2 T C 16: 97,412,188 probably null Het
BC051142 A T 17: 34,421,862 H57L possibly damaging Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Clca3a2 T A 3: 144,813,918 T232S probably benign Het
Col1a2 G A 6: 4,519,882 probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Cpd T C 11: 76,811,859 N561S probably damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dnah10 T C 5: 124,819,412 probably null Het
Dsg2 T C 18: 20,579,128 F107S probably damaging Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fermt2 A C 14: 45,504,491 probably null Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Grtp1 G A 8: 13,189,755 probably benign Het
Hecw1 G T 13: 14,245,836 Q1001K possibly damaging Het
Hydin T C 8: 110,404,295 V606A possibly damaging Het
Krt33b T A 11: 100,024,009 N388I probably benign Het
Lipf T C 19: 33,973,038 Y277H probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Maats1 A T 16: 38,311,038 I471N possibly damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Med17 T C 9: 15,275,891 K196E probably damaging Het
Mmp25 T A 17: 23,644,791 I22F probably benign Het
Nrg3 T A 14: 38,371,008 N540I possibly damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr584 T A 7: 103,086,341 H269Q probably benign Het
Olfr600 T C 7: 103,346,065 M288V probably benign Het
Pcdh1 G T 18: 38,189,762 A1006E probably benign Het
Pdss1 T A 2: 22,906,787 probably null Het
Plaa G A 4: 94,569,459 A758V probably damaging Het
Prl6a1 T A 13: 27,315,320 W24R probably damaging Het
Ptk7 T C 17: 46,572,550 H863R probably damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Rhou T C 8: 123,661,141 I204T possibly damaging Het
Serpind1 G T 16: 17,337,108 M266I probably benign Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Slc2a2 T G 3: 28,718,771 C238G probably damaging Het
Slc39a8 A G 3: 135,886,823 M420V probably benign Het
Slc7a9 C A 7: 35,463,742 Y457* probably null Het
Smpd3 C T 8: 106,264,820 R367H probably damaging Het
Sntb2 T C 8: 106,936,097 V99A probably benign Het
Specc1l T G 10: 75,259,131 I796R probably damaging Het
Stfa2l1 G T 16: 36,159,946 V29F probably damaging Het
Synrg T C 11: 83,994,354 F455S probably damaging Het
Tap2 T C 17: 34,212,354 V422A possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tcp10a A G 17: 7,329,774 Y110C probably damaging Het
Thoc1 T A 18: 9,959,255 S43R probably damaging Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Trpc3 G A 3: 36,634,383 R836* probably null Het
Ube2u T C 4: 100,524,298 S185P possibly damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vcp A G 4: 42,980,846 Y755H probably damaging Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdfy3 A T 5: 101,944,122 F450L probably benign Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Xylt1 C A 7: 117,634,784 Q513K probably benign Het
Zfp229 T C 17: 21,745,503 F238S probably damaging Het
Other mutations in Cbarp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02516:Cbarp APN 10 80135545 missense probably damaging 1.00
R1181:Cbarp UTSW 10 80135494 missense probably damaging 1.00
R1189:Cbarp UTSW 10 80131796 missense possibly damaging 0.77
R2938:Cbarp UTSW 10 80131769 missense probably damaging 0.99
R3931:Cbarp UTSW 10 80135514 missense probably damaging 1.00
R4199:Cbarp UTSW 10 80135492 missense probably damaging 1.00
R4573:Cbarp UTSW 10 80131411 missense probably damaging 0.99
R5274:Cbarp UTSW 10 80131815 missense possibly damaging 0.57
R5761:Cbarp UTSW 10 80132233 unclassified probably benign
R6112:Cbarp UTSW 10 80135371 splice site probably null
R6402:Cbarp UTSW 10 80135122 missense probably benign
R7087:Cbarp UTSW 10 80136408 missense probably damaging 1.00
R7270:Cbarp UTSW 10 80137317 missense possibly damaging 0.63
R7287:Cbarp UTSW 10 80137320 missense unknown
X0025:Cbarp UTSW 10 80131577 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAGGACAATCAACGCTGTC -3'
(R):5'- TGCTTTGAGGCCTAAGGACG -3'

Sequencing Primer
(F):5'- CGTAATGGCGCACGTGTAG -3'
(R):5'- GCCTAAGGACGGCGAAG -3'
Posted On2014-12-29