Incidental Mutation 'R2937:Anks1b'
ID255081
Institutional Source Beutler Lab
Gene Symbol Anks1b
Ensembl Gene ENSMUSG00000058589
Gene Nameankyrin repeat and sterile alpha motif domain containing 1B
SynonymsC030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik
MMRRC Submission 040514-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R2937 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location89873509-90973300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 90077066 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 351 (T351M)
Ref Sequence ENSEMBL: ENSMUSP00000138539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099368] [ENSMUST00000182907] [ENSMUST00000182936] [ENSMUST00000183156]
Predicted Effect probably damaging
Transcript: ENSMUST00000099368
AA Change: T351M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589
AA Change: T351M

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 931 4.44e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182907
SMART Domains Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182936
AA Change: T317M

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138209
Gene: ENSMUSG00000058589
AA Change: T317M

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 5.03e2 SMART
low complexity region 464 479 N/A INTRINSIC
low complexity region 517 543 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000183109
AA Change: T88M
Predicted Effect probably damaging
Transcript: ENSMUST00000183156
AA Change: T351M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589
AA Change: T351M

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 948 5.66e-17 SMART
low complexity region 968 983 N/A INTRINSIC
PTB 1056 1194 2.94e-38 SMART
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,659,127 E481G probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Asph A C 4: 9,542,314 probably benign Het
Bace2 T C 16: 97,412,188 probably null Het
BC051142 A T 17: 34,421,862 H57L possibly damaging Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Clca3a2 T A 3: 144,813,918 T232S probably benign Het
Col1a2 G A 6: 4,519,882 probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Cpd T C 11: 76,811,859 N561S probably damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dnah10 T C 5: 124,819,412 probably null Het
Dsg2 T C 18: 20,579,128 F107S probably damaging Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fermt2 A C 14: 45,504,491 probably null Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Grtp1 G A 8: 13,189,755 probably benign Het
Hecw1 G T 13: 14,245,836 Q1001K possibly damaging Het
Hydin T C 8: 110,404,295 V606A possibly damaging Het
Krt33b T A 11: 100,024,009 N388I probably benign Het
Lipf T C 19: 33,973,038 Y277H probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Maats1 A T 16: 38,311,038 I471N possibly damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Med17 T C 9: 15,275,891 K196E probably damaging Het
Mmp25 T A 17: 23,644,791 I22F probably benign Het
Nrg3 T A 14: 38,371,008 N540I possibly damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr584 T A 7: 103,086,341 H269Q probably benign Het
Olfr600 T C 7: 103,346,065 M288V probably benign Het
Pcdh1 G T 18: 38,189,762 A1006E probably benign Het
Pdss1 T A 2: 22,906,787 probably null Het
Plaa G A 4: 94,569,459 A758V probably damaging Het
Prl6a1 T A 13: 27,315,320 W24R probably damaging Het
Ptk7 T C 17: 46,572,550 H863R probably damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Rhou T C 8: 123,661,141 I204T possibly damaging Het
Serpind1 G T 16: 17,337,108 M266I probably benign Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Slc2a2 T G 3: 28,718,771 C238G probably damaging Het
Slc39a8 A G 3: 135,886,823 M420V probably benign Het
Slc7a9 C A 7: 35,463,742 Y457* probably null Het
Smpd3 C T 8: 106,264,820 R367H probably damaging Het
Sntb2 T C 8: 106,936,097 V99A probably benign Het
Specc1l T G 10: 75,259,131 I796R probably damaging Het
Stfa2l1 G T 16: 36,159,946 V29F probably damaging Het
Synrg T C 11: 83,994,354 F455S probably damaging Het
Tap2 T C 17: 34,212,354 V422A possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tcp10a A G 17: 7,329,774 Y110C probably damaging Het
Thoc1 T A 18: 9,959,255 S43R probably damaging Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Trpc3 G A 3: 36,634,383 R836* probably null Het
Ube2u T C 4: 100,524,298 S185P possibly damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vcp A G 4: 42,980,846 Y755H probably damaging Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdfy3 A T 5: 101,944,122 F450L probably benign Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Xylt1 C A 7: 117,634,784 Q513K probably benign Het
Zfp229 T C 17: 21,745,503 F238S probably damaging Het
Other mutations in Anks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Anks1b APN 10 90897238 splice site probably benign
IGL01890:Anks1b APN 10 90644527 missense probably benign 0.15
IGL01966:Anks1b APN 10 90895132 missense probably damaging 1.00
IGL02176:Anks1b APN 10 90042668 missense probably damaging 0.99
IGL02205:Anks1b APN 10 90071094 missense probably benign 0.00
IGL02465:Anks1b APN 10 90163265 nonsense probably null
IGL02534:Anks1b APN 10 90895117 missense probably benign 0.45
IGL02554:Anks1b APN 10 90921378 missense probably damaging 1.00
IGL02820:Anks1b APN 10 90077059 missense possibly damaging 0.93
IGL03164:Anks1b APN 10 90042692 missense probably damaging 1.00
R0096:Anks1b UTSW 10 90074062 missense possibly damaging 0.90
R0482:Anks1b UTSW 10 90359195 missense probably benign 0.00
R0542:Anks1b UTSW 10 90073967 splice site probably benign
R0848:Anks1b UTSW 10 90071125 missense probably damaging 0.99
R1056:Anks1b UTSW 10 90921429 splice site probably null
R1398:Anks1b UTSW 10 90050029 missense probably damaging 1.00
R1446:Anks1b UTSW 10 90511073 missense probably benign 0.00
R1548:Anks1b UTSW 10 90049985 missense possibly damaging 0.79
R1551:Anks1b UTSW 10 90076981 missense probably benign 0.00
R1607:Anks1b UTSW 10 90042548 missense probably damaging 1.00
R1667:Anks1b UTSW 10 90511184 critical splice donor site probably null
R1701:Anks1b UTSW 10 90049954 missense probably damaging 1.00
R1843:Anks1b UTSW 10 90512889 critical splice donor site probably null
R1899:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R1957:Anks1b UTSW 10 90049930 missense probably damaging 1.00
R2036:Anks1b UTSW 10 90969853 missense probably damaging 0.99
R2279:Anks1b UTSW 10 90050096 missense probably damaging 1.00
R2280:Anks1b UTSW 10 90966302 missense probably damaging 1.00
R3739:Anks1b UTSW 10 90033216 missense probably damaging 1.00
R4061:Anks1b UTSW 10 90307622 missense probably damaging 0.98
R4459:Anks1b UTSW 10 90510844 missense probably damaging 1.00
R4479:Anks1b UTSW 10 90049892 missense probably damaging 1.00
R4510:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4511:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4780:Anks1b UTSW 10 89873732 missense probably damaging 1.00
R4785:Anks1b UTSW 10 90914750 missense probably null 0.88
R4790:Anks1b UTSW 10 90163275 missense probably damaging 0.99
R5012:Anks1b UTSW 10 90359137 missense probably benign 0.06
R5400:Anks1b UTSW 10 90512824 missense probably damaging 1.00
R5586:Anks1b UTSW 10 90077064 missense probably damaging 0.98
R5687:Anks1b UTSW 10 90914711 missense probably benign 0.03
R5899:Anks1b UTSW 10 90923517 splice site probably null
R5917:Anks1b UTSW 10 90576941 intron probably benign
R5999:Anks1b UTSW 10 90359048 missense probably damaging 1.00
R6080:Anks1b UTSW 10 90966349 nonsense probably null
R6216:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R6265:Anks1b UTSW 10 90941500 missense probably damaging 1.00
R6298:Anks1b UTSW 10 90680837 missense probably damaging 1.00
R6337:Anks1b UTSW 10 90921296 missense probably benign 0.27
R6522:Anks1b UTSW 10 90897327 intron probably benign
R6843:Anks1b UTSW 10 90948598 missense probably damaging 1.00
R6852:Anks1b UTSW 10 90260654 missense probably damaging 1.00
R6933:Anks1b UTSW 10 90069490 missense probably damaging 1.00
R7114:Anks1b UTSW 10 90307698 missense probably damaging 1.00
R7211:Anks1b UTSW 10 90511070 missense possibly damaging 0.94
R7241:Anks1b UTSW 10 90512837 missense probably damaging 1.00
R7264:Anks1b UTSW 10 90512870 missense probably benign 0.08
X0064:Anks1b UTSW 10 90512845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTGTCCTCTGTCAACACGG -3'
(R):5'- AGGGACATTGACATTTGATCAGC -3'

Sequencing Primer
(F):5'- ACGGCAGTCTCACTTACATG -3'
(R):5'- GACATTTGATCAGCGCTGAATCCG -3'
Posted On2014-12-29