Incidental Mutation 'R0325:Fmn2'
ID25684
Institutional Source Beutler Lab
Gene Symbol Fmn2
Ensembl Gene ENSMUSG00000028354
Gene Nameformin 2
Synonyms
MMRRC Submission 038535-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.670) question?
Stock #R0325 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174501825-174822729 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 174609954 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030039]
Predicted Effect probably null
Transcript: ENSMUST00000030039
SMART Domains Protein: ENSMUSP00000030039
Gene: ENSMUSG00000028354

DomainStartEndE-ValueType
low complexity region 35 69 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
low complexity region 304 334 N/A INTRINSIC
Blast:FH2 353 577 2e-97 BLAST
low complexity region 604 616 N/A INTRINSIC
coiled coil region 645 681 N/A INTRINSIC
Blast:FH2 710 788 2e-14 BLAST
low complexity region 796 831 N/A INTRINSIC
Pfam:Drf_FH1 942 1048 3.1e-16 PFAM
low complexity region 1117 1131 N/A INTRINSIC
FH2 1139 1543 1.29e-85 SMART
PDB:2YLE|B 1550 1578 4e-11 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195300
Predicted Effect probably null
Transcript: ENSMUST00000195621
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the formin homology protein family. The encoded protein is thought to have essential roles in organization of the actin cytoskeleton and in cell polarity. Mutations in this gene have been associated with mental retardation autosomal recessive 47 (MRT47). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Female mice homozygous for a knock-out allele display polyploid embryo formation, recurrent pregnancy loss, hypofertility, and inadequate nursing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,266 Q278K possibly damaging Het
4933416C03Rik T C 10: 116,113,569 I17M probably damaging Het
5330417C22Rik A G 3: 108,461,251 L808P probably damaging Het
Adcyap1 A G 17: 93,202,832 D96G probably benign Het
Adgrv1 C T 13: 81,540,015 V1749M probably damaging Het
Adnp2 A T 18: 80,130,653 N180K probably benign Het
Ahdc1 G T 4: 133,062,719 A424S unknown Het
Alpk3 G A 7: 81,067,953 R86H possibly damaging Het
Atf7ip A C 6: 136,560,989 T49P possibly damaging Het
Atp7b G A 8: 22,028,451 L124F probably benign Het
Bub1 A T 2: 127,801,394 L1010* probably null Het
Cd300c C A 11: 114,959,585 E131* probably null Het
Cep135 A G 5: 76,615,743 K527E probably damaging Het
Cfd G T 10: 79,891,758 E89* probably null Het
Crb1 A C 1: 139,241,166 C871W probably damaging Het
D6Ertd527e A T 6: 87,111,295 S147C unknown Het
Ddx60 A T 8: 61,983,855 E946D probably benign Het
Dmrt1 G A 19: 25,546,007 E241K probably benign Het
Dnah11 C G 12: 118,012,339 V2782L probably benign Het
Dzip1 T C 14: 118,909,557 I313M probably damaging Het
Egln3 T C 12: 54,203,512 E17G probably benign Het
Eif3d A G 15: 77,968,220 V42A probably damaging Het
Eogt C A 6: 97,113,955 G408W probably damaging Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Fndc3b T C 3: 27,467,430 E532G probably damaging Het
Gabrb3 T C 7: 57,765,530 L116P probably damaging Het
Galnt6 A T 15: 100,693,471 probably null Het
Glmp G A 3: 88,325,084 M1I probably null Het
Gm13101 A T 4: 143,966,740 V56E probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gm5478 T C 15: 101,644,326 D79G probably damaging Het
Gnb1 T G 4: 155,551,683 D153E probably benign Het
Grik2 T C 10: 49,240,725 I86V probably damaging Het
Hdac3 C T 18: 37,940,952 probably null Het
Hdgfl2 G A 17: 56,099,181 R523H possibly damaging Het
Ifngr1 T A 10: 19,597,432 N43K probably damaging Het
Iqgap1 A G 7: 80,751,930 W476R probably benign Het
Jag1 A G 2: 137,095,445 probably null Het
Kars T C 8: 112,008,216 D46G probably benign Het
Kcnd2 A G 6: 21,216,683 I129V probably damaging Het
Lama3 A C 18: 12,482,126 D1369A probably damaging Het
Lars A T 18: 42,250,902 V76E possibly damaging Het
Lgals9 T C 11: 78,963,448 I337V probably damaging Het
Lrp1b T C 2: 40,851,711 D3068G probably damaging Het
Med12l A G 3: 59,077,059 T462A possibly damaging Het
Megf9 T A 4: 70,455,941 D286V probably damaging Het
Meox1 T A 11: 101,879,401 S167C probably damaging Het
Mier2 C T 10: 79,542,596 probably null Het
Mrps2 C A 2: 28,469,779 T216K probably damaging Het
Mto1 A T 9: 78,453,004 D258V probably damaging Het
Mug1 A T 6: 121,849,842 H208L probably benign Het
Myo15b T A 11: 115,884,265 I751N probably damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg4 T A 8: 95,710,935 M17K probably damaging Het
Nfrkb T G 9: 31,414,180 M973R probably benign Het
Nxph4 C T 10: 127,526,911 R37H probably damaging Het
Oas1e A G 5: 120,795,395 I35T probably damaging Het
Oc90 C T 15: 65,897,665 probably null Het
Olfr1045 G A 2: 86,198,711 L14F possibly damaging Het
Olfr1076 A T 2: 86,509,205 T249S probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Olfr461 A T 6: 40,544,123 N285K possibly damaging Het
Olfr653 A T 7: 104,580,360 D238V probably damaging Het
Papola T A 12: 105,807,193 I157N probably damaging Het
Pcyox1l G C 18: 61,697,893 P303A possibly damaging Het
Pkdrej T C 15: 85,819,551 N728S probably benign Het
Pkp4 A G 2: 59,318,529 D542G probably damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Poln C T 5: 34,149,764 R31H probably benign Het
Ppp3ca G A 3: 136,935,139 A484T probably benign Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Prex2 G A 1: 11,200,057 probably null Het
Prrc2b G T 2: 32,199,091 W403L probably damaging Het
Pter A T 2: 13,000,937 K307M probably damaging Het
Ptpn5 G A 7: 47,090,758 S99L probably benign Het
Ptpn5 A C 7: 47,090,759 S99A probably benign Het
Rpap1 A C 2: 119,771,840 H674Q probably benign Het
Rph3a A T 5: 120,943,064 D623E probably benign Het
Sdr9c7 G T 10: 127,898,719 E25D probably benign Het
Sept9 T G 11: 117,356,632 V479G probably damaging Het
Sgo2a A G 1: 58,016,697 D680G probably benign Het
Sgo2b A T 8: 63,928,376 I474N probably benign Het
Sgsm1 A T 5: 113,288,835 I43N probably damaging Het
Shprh G A 10: 11,170,109 M891I probably benign Het
Skiv2l A T 17: 34,844,815 Y551N possibly damaging Het
Slc12a9 A G 5: 137,322,846 M469T probably damaging Het
Slc4a2 A T 5: 24,435,943 I747F probably damaging Het
Slc7a6 T A 8: 106,194,517 N373K probably damaging Het
Slc7a6os T C 8: 106,201,056 D296G probably benign Het
Sncaip A G 18: 52,905,809 T120A probably damaging Het
Sorcs1 G C 19: 50,313,042 probably null Het
Spata16 A G 3: 26,667,456 E42G probably damaging Het
Syne2 A T 12: 75,962,641 M2440L probably benign Het
Tead2 A G 7: 45,225,755 E232G probably damaging Het
Tmf1 T G 6: 97,176,504 T203P possibly damaging Het
Trrap C A 5: 144,816,395 H1843Q probably benign Het
Unc79 C A 12: 103,171,644 Q2314K probably damaging Het
Unc80 G T 1: 66,510,881 G766V probably damaging Het
Vmn1r217 A G 13: 23,114,594 L46P probably damaging Het
Vmn2r80 A T 10: 79,148,939 I42F possibly damaging Het
Vwa5a T C 9: 38,728,665 V403A probably damaging Het
Zfp42 T C 8: 43,295,951 E171G probably damaging Het
Zfp64 A T 2: 168,926,040 S551T probably benign Het
Other mutations in Fmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fmn2 APN 1 174503319 missense unknown
IGL01085:Fmn2 APN 1 174695654 missense probably damaging 1.00
IGL01784:Fmn2 APN 1 174502428 missense unknown
IGL02095:Fmn2 APN 1 174502601 missense unknown
IGL02330:Fmn2 APN 1 174609945 missense probably benign 0.38
IGL02552:Fmn2 APN 1 174695720 missense probably damaging 1.00
IGL02835:Fmn2 UTSW 1 174582059 missense unknown
R0025:Fmn2 UTSW 1 174791314 missense probably damaging 1.00
R0062:Fmn2 UTSW 1 174608449 unclassified probably benign
R0062:Fmn2 UTSW 1 174608449 unclassified probably benign
R0306:Fmn2 UTSW 1 174609484 unclassified probably benign
R0403:Fmn2 UTSW 1 174694278 missense probably damaging 1.00
R0491:Fmn2 UTSW 1 174581959 missense unknown
R0898:Fmn2 UTSW 1 174503460 missense unknown
R1202:Fmn2 UTSW 1 174612535 nonsense probably null
R1719:Fmn2 UTSW 1 174608458 unclassified probably benign
R1763:Fmn2 UTSW 1 174502266 missense unknown
R1771:Fmn2 UTSW 1 174608776 unclassified probably benign
R1777:Fmn2 UTSW 1 174581922 missense unknown
R1831:Fmn2 UTSW 1 174609945 missense probably benign 0.38
R2259:Fmn2 UTSW 1 174502932 missense unknown
R2960:Fmn2 UTSW 1 174609819 missense probably damaging 1.00
R3545:Fmn2 UTSW 1 174502626 missense unknown
R3840:Fmn2 UTSW 1 174582033 frame shift probably null
R4207:Fmn2 UTSW 1 174581955 missense unknown
R4679:Fmn2 UTSW 1 174503162 missense unknown
R4779:Fmn2 UTSW 1 174609895 missense probably damaging 1.00
R4887:Fmn2 UTSW 1 174581961 missense unknown
R4926:Fmn2 UTSW 1 174502415 missense unknown
R5007:Fmn2 UTSW 1 174744300 missense probably damaging 1.00
R5247:Fmn2 UTSW 1 174821228 missense probably benign 0.04
R5324:Fmn2 UTSW 1 174608880 unclassified probably benign
R5353:Fmn2 UTSW 1 174503006 missense unknown
R5420:Fmn2 UTSW 1 174698778 nonsense probably null
R5607:Fmn2 UTSW 1 174609811 missense probably damaging 0.97
R5668:Fmn2 UTSW 1 174582037 missense unknown
R5982:Fmn2 UTSW 1 174502453 missense unknown
R6148:Fmn2 UTSW 1 174666663 missense probably damaging 1.00
R6324:Fmn2 UTSW 1 174612553 missense possibly damaging 0.87
R6466:Fmn2 UTSW 1 174609583 unclassified probably benign
R6647:Fmn2 UTSW 1 174593104 missense unknown
R6835:Fmn2 UTSW 1 174699669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTAGCACTTTACCAGCAGCAC -3'
(R):5'- GGCAGTCAAGACCTGCAACTACAG -3'

Sequencing Primer
(F):5'- CACCTCAAGGGTGTGGATTTC -3'
(R):5'- TCTCAGACAGAGATGTAAAAATGCC -3'
Posted On2013-04-16