Incidental Mutation 'R0325:Spata16'
ID25696
Institutional Source Beutler Lab
Gene Symbol Spata16
Ensembl Gene ENSMUSG00000039335
Gene Namespermatogenesis associated 16
Synonymsspermatogenesis-related protein, 4921511F01Rik, 4930503K02Rik, Nyd-sp12
MMRRC Submission 038535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R0325 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location26637620-26983212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26667456 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 42 (E42G)
Ref Sequence ENSEMBL: ENSMUSP00000103941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047005] [ENSMUST00000108305]
Predicted Effect probably damaging
Transcript: ENSMUST00000047005
AA Change: E42G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043378
Gene: ENSMUSG00000039335
AA Change: E42G

DomainStartEndE-ValueType
Pfam:NYD-SP12_N 5 569 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108305
AA Change: E42G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103941
Gene: ENSMUSG00000039335
AA Change: E42G

DomainStartEndE-ValueType
Pfam:NYD-SP12_N 1 534 N/A PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a testis-specific protein that belongs to the tetratricopeptide repeat-like superfamily. The encoded protein localizes to the Golgi apparatus and may play a role in spermatogenesis. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,266 Q278K possibly damaging Het
4933416C03Rik T C 10: 116,113,569 I17M probably damaging Het
5330417C22Rik A G 3: 108,461,251 L808P probably damaging Het
Adcyap1 A G 17: 93,202,832 D96G probably benign Het
Adgrv1 C T 13: 81,540,015 V1749M probably damaging Het
Adnp2 A T 18: 80,130,653 N180K probably benign Het
Ahdc1 G T 4: 133,062,719 A424S unknown Het
Alpk3 G A 7: 81,067,953 R86H possibly damaging Het
Atf7ip A C 6: 136,560,989 T49P possibly damaging Het
Atp7b G A 8: 22,028,451 L124F probably benign Het
Bub1 A T 2: 127,801,394 L1010* probably null Het
Cd300c C A 11: 114,959,585 E131* probably null Het
Cep135 A G 5: 76,615,743 K527E probably damaging Het
Cfd G T 10: 79,891,758 E89* probably null Het
Crb1 A C 1: 139,241,166 C871W probably damaging Het
D6Ertd527e A T 6: 87,111,295 S147C unknown Het
Ddx60 A T 8: 61,983,855 E946D probably benign Het
Dmrt1 G A 19: 25,546,007 E241K probably benign Het
Dnah11 C G 12: 118,012,339 V2782L probably benign Het
Dzip1 T C 14: 118,909,557 I313M probably damaging Het
Egln3 T C 12: 54,203,512 E17G probably benign Het
Eif3d A G 15: 77,968,220 V42A probably damaging Het
Eogt C A 6: 97,113,955 G408W probably damaging Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Fmn2 T A 1: 174,609,954 probably null Het
Fndc3b T C 3: 27,467,430 E532G probably damaging Het
Gabrb3 T C 7: 57,765,530 L116P probably damaging Het
Galnt6 A T 15: 100,693,471 probably null Het
Glmp G A 3: 88,325,084 M1I probably null Het
Gm13101 A T 4: 143,966,740 V56E probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gm5478 T C 15: 101,644,326 D79G probably damaging Het
Gnb1 T G 4: 155,551,683 D153E probably benign Het
Grik2 T C 10: 49,240,725 I86V probably damaging Het
Hdac3 C T 18: 37,940,952 probably null Het
Hdgfl2 G A 17: 56,099,181 R523H possibly damaging Het
Ifngr1 T A 10: 19,597,432 N43K probably damaging Het
Iqgap1 A G 7: 80,751,930 W476R probably benign Het
Jag1 A G 2: 137,095,445 probably null Het
Kars T C 8: 112,008,216 D46G probably benign Het
Kcnd2 A G 6: 21,216,683 I129V probably damaging Het
Lama3 A C 18: 12,482,126 D1369A probably damaging Het
Lars A T 18: 42,250,902 V76E possibly damaging Het
Lgals9 T C 11: 78,963,448 I337V probably damaging Het
Lrp1b T C 2: 40,851,711 D3068G probably damaging Het
Med12l A G 3: 59,077,059 T462A possibly damaging Het
Megf9 T A 4: 70,455,941 D286V probably damaging Het
Meox1 T A 11: 101,879,401 S167C probably damaging Het
Mier2 C T 10: 79,542,596 probably null Het
Mrps2 C A 2: 28,469,779 T216K probably damaging Het
Mto1 A T 9: 78,453,004 D258V probably damaging Het
Mug1 A T 6: 121,849,842 H208L probably benign Het
Myo15b T A 11: 115,884,265 I751N probably damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg4 T A 8: 95,710,935 M17K probably damaging Het
Nfrkb T G 9: 31,414,180 M973R probably benign Het
Nxph4 C T 10: 127,526,911 R37H probably damaging Het
Oas1e A G 5: 120,795,395 I35T probably damaging Het
Oc90 C T 15: 65,897,665 probably null Het
Olfr1045 G A 2: 86,198,711 L14F possibly damaging Het
Olfr1076 A T 2: 86,509,205 T249S probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Olfr461 A T 6: 40,544,123 N285K possibly damaging Het
Olfr653 A T 7: 104,580,360 D238V probably damaging Het
Papola T A 12: 105,807,193 I157N probably damaging Het
Pcyox1l G C 18: 61,697,893 P303A possibly damaging Het
Pkdrej T C 15: 85,819,551 N728S probably benign Het
Pkp4 A G 2: 59,318,529 D542G probably damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Poln C T 5: 34,149,764 R31H probably benign Het
Ppp3ca G A 3: 136,935,139 A484T probably benign Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Prex2 G A 1: 11,200,057 probably null Het
Prrc2b G T 2: 32,199,091 W403L probably damaging Het
Pter A T 2: 13,000,937 K307M probably damaging Het
Ptpn5 G A 7: 47,090,758 S99L probably benign Het
Ptpn5 A C 7: 47,090,759 S99A probably benign Het
Rpap1 A C 2: 119,771,840 H674Q probably benign Het
Rph3a A T 5: 120,943,064 D623E probably benign Het
Sdr9c7 G T 10: 127,898,719 E25D probably benign Het
Sept9 T G 11: 117,356,632 V479G probably damaging Het
Sgo2a A G 1: 58,016,697 D680G probably benign Het
Sgo2b A T 8: 63,928,376 I474N probably benign Het
Sgsm1 A T 5: 113,288,835 I43N probably damaging Het
Shprh G A 10: 11,170,109 M891I probably benign Het
Skiv2l A T 17: 34,844,815 Y551N possibly damaging Het
Slc12a9 A G 5: 137,322,846 M469T probably damaging Het
Slc4a2 A T 5: 24,435,943 I747F probably damaging Het
Slc7a6 T A 8: 106,194,517 N373K probably damaging Het
Slc7a6os T C 8: 106,201,056 D296G probably benign Het
Sncaip A G 18: 52,905,809 T120A probably damaging Het
Sorcs1 G C 19: 50,313,042 probably null Het
Syne2 A T 12: 75,962,641 M2440L probably benign Het
Tead2 A G 7: 45,225,755 E232G probably damaging Het
Tmf1 T G 6: 97,176,504 T203P possibly damaging Het
Trrap C A 5: 144,816,395 H1843Q probably benign Het
Unc79 C A 12: 103,171,644 Q2314K probably damaging Het
Unc80 G T 1: 66,510,881 G766V probably damaging Het
Vmn1r217 A G 13: 23,114,594 L46P probably damaging Het
Vmn2r80 A T 10: 79,148,939 I42F possibly damaging Het
Vwa5a T C 9: 38,728,665 V403A probably damaging Het
Zfp42 T C 8: 43,295,951 E171G probably damaging Het
Zfp64 A T 2: 168,926,040 S551T probably benign Het
Other mutations in Spata16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Spata16 APN 3 26924262 missense probably damaging 0.98
IGL01017:Spata16 APN 3 26840722 missense possibly damaging 0.93
IGL01129:Spata16 APN 3 26913184 splice site probably benign
IGL01330:Spata16 APN 3 26914715 missense probably damaging 0.99
IGL02033:Spata16 APN 3 26913334 critical splice donor site probably null
IGL02069:Spata16 APN 3 26732795 nonsense probably null
IGL02231:Spata16 APN 3 26913264 missense probably damaging 1.00
R0084:Spata16 UTSW 3 26667410 missense possibly damaging 0.95
R0109:Spata16 UTSW 3 26913267 missense probably damaging 0.97
R0109:Spata16 UTSW 3 26913267 missense probably damaging 0.97
R0811:Spata16 UTSW 3 26913338 splice site probably benign
R2061:Spata16 UTSW 3 26924370 missense probably damaging 0.99
R3148:Spata16 UTSW 3 26878712 critical splice donor site probably null
R4837:Spata16 UTSW 3 26732932 missense possibly damaging 0.93
R4972:Spata16 UTSW 3 26840723 missense possibly damaging 0.93
R5129:Spata16 UTSW 3 26667564 missense probably damaging 0.98
R5235:Spata16 UTSW 3 26667632 missense probably benign 0.00
R5458:Spata16 UTSW 3 26777537 missense probably damaging 0.99
R6578:Spata16 UTSW 3 26667548 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTCAGTGTGAACAGTCAGTGC -3'
(R):5'- GGGCAAACTCATAGCTCACATCCTC -3'

Sequencing Primer
(F):5'- CAGTCAGTGCATAGTATAAATGCAGC -3'
(R):5'- TGACTAGCTGATTGTCTAGTTCC -3'
Posted On2013-04-16