Incidental Mutation 'R0326:Itgad'
ID25855
Institutional Source Beutler Lab
Gene Symbol Itgad
Ensembl Gene ENSMUSG00000070369
Gene Nameintegrin, alpha D
SynonymsCd11d
MMRRC Submission 038536-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0326 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128154376-128223816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128198378 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 893 (F893Y)
Ref Sequence ENSEMBL: ENSMUSP00000101844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033051] [ENSMUST00000106237] [ENSMUST00000177111]
Predicted Effect probably benign
Transcript: ENSMUST00000033051
AA Change: F927Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033051
Gene: ENSMUSG00000070369
AA Change: F927Y

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 376 1.24e-36 SMART
Blast:VWA 405 436 1e-9 BLAST
Int_alpha 443 492 3.67e-3 SMART
Int_alpha 496 553 1.03e-6 SMART
Int_alpha 559 615 1.73e-13 SMART
Int_alpha 622 676 1.69e-2 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Pfam:Integrin_alpha 1165 1179 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106237
AA Change: F893Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101844
Gene: ENSMUSG00000070369
AA Change: F893Y

DomainStartEndE-ValueType
Int_alpha 40 90 1.35e1 SMART
VWA 157 342 1.31e-44 SMART
Blast:VWA 371 402 9e-10 BLAST
Int_alpha 409 458 3.67e-3 SMART
Int_alpha 462 519 1.03e-6 SMART
Int_alpha 525 581 1.73e-13 SMART
Int_alpha 588 642 1.69e-2 SMART
transmembrane domain 1108 1130 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 4.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177111
AA Change: F891Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135572
Gene: ENSMUSG00000070369
AA Change: F891Y

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Int_alpha 38 88 1.35e1 SMART
VWA 155 340 1.31e-44 SMART
Blast:VWA 369 400 9e-10 BLAST
Int_alpha 407 456 3.67e-3 SMART
Int_alpha 460 517 1.03e-6 SMART
Int_alpha 523 579 1.73e-13 SMART
Int_alpha 586 640 1.69e-2 SMART
transmembrane domain 1106 1128 N/A INTRINSIC
Pfam:Integrin_alpha 1129 1143 5.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205646
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the beta-2 integrin family of membrane glycoproteins, which are are composed of non-covalently linked alpha and beta subunits to form a heterodimer. It encodes the alpha subunit of the cell surface heterodimers and is involved in the activation and adhesion functions of leukocytes. The gene is located about 11kb downstream of the integrin subunit alpha X gene, another member of the integrin family. It is expressed in the tissue and circulating myeloid leukocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice exhibit a reduced staphylococcal enterotoxin-induced T cell response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C T 1: 130,742,898 P286S possibly damaging Het
Aagab T A 9: 63,619,162 S156T probably damaging Het
Abca14 T G 7: 120,224,419 Y390D probably damaging Het
Abcc2 T A 19: 43,825,947 I1122N possibly damaging Het
Adamts16 T C 13: 70,779,611 E503G possibly damaging Het
Adamts9 A T 6: 92,858,057 C697* probably null Het
Adgrv1 T C 13: 81,474,993 D3837G possibly damaging Het
Aire T A 10: 78,042,599 R128S probably damaging Het
Alkbh2 A C 5: 114,123,950 *240E probably null Het
Als2 T C 1: 59,180,583 Y1191C probably damaging Het
Anapc5 A T 5: 122,814,604 V186E probably benign Het
Apob C T 12: 7,990,307 A548V probably damaging Het
B3galt4 A T 17: 33,950,748 V172E probably damaging Het
Bbs7 A C 3: 36,592,376 C432G possibly damaging Het
Cacna2d3 T A 14: 29,045,644 E758V probably damaging Het
Cactin T G 10: 81,322,662 L154R probably benign Het
Ccdc129 A T 6: 55,898,243 M393L possibly damaging Het
Ccdc88a A C 11: 29,461,021 R502S probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Chd1 A T 17: 15,768,566 D1527V probably damaging Het
Chd1 A T 17: 15,768,568 M1528L probably benign Het
Chrac1 G A 15: 73,092,826 probably null Het
Cln3 T G 7: 126,583,045 M1L probably damaging Het
Cnot6 T C 11: 49,677,436 Y442C probably damaging Het
Col19a1 A T 1: 24,285,051 probably null Het
Col1a2 T C 6: 4,537,838 F1116L unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cops4 T G 5: 100,528,542 V53G probably damaging Het
Crnkl1 A G 2: 145,919,955 S561P probably benign Het
Ctnnb1 C A 9: 120,951,712 Q99K probably benign Het
Cxcr5 T C 9: 44,513,281 S360G probably benign Het
Dab2 G A 15: 6,418,316 V60M probably damaging Het
Ddx3y A T Y: 1,263,321 Y648* probably null Het
Dennd2a T A 6: 39,497,110 D430V probably damaging Het
Dsp G T 13: 38,192,870 E1544* probably null Het
Efcab7 A T 4: 99,831,394 M38L possibly damaging Het
Fto A G 8: 91,409,527 N141S probably damaging Het
Gabrp A G 11: 33,554,362 F318L probably damaging Het
Gm4737 T A 16: 46,153,883 D377V probably benign Het
Gmeb1 A C 4: 132,242,352 C103W probably damaging Het
Heatr9 T C 11: 83,514,539 D365G probably damaging Het
Hif3a G A 7: 17,044,400 R436W probably benign Het
Hint2 A G 4: 43,654,378 V145A probably damaging Het
Hmcn2 T A 2: 31,423,225 L3482* probably null Het
Hsd3b1 A T 3: 98,853,274 Y134N probably damaging Het
Impg2 T A 16: 56,260,485 V775E probably damaging Het
Ipo5 A G 14: 120,922,223 I154M probably benign Het
Kdm4a T C 4: 118,161,706 R438G probably benign Het
Klk11 T A 7: 43,776,519 M1K probably null Het
Lama5 A T 2: 180,182,426 V2602D possibly damaging Het
Lrch3 T C 16: 32,979,500 S35P probably damaging Het
Mfn2 A G 4: 147,883,288 L441P probably damaging Het
Mgat4c A T 10: 102,388,704 I260F probably damaging Het
Mon1b T A 8: 113,637,743 S51T probably benign Het
Myh11 T C 16: 14,218,880 D993G probably benign Het
Myo1a A G 10: 127,716,297 N762D probably benign Het
Nacc2 A T 2: 26,060,333 Y464N probably damaging Het
Nckap1 A G 2: 80,553,370 I150T probably benign Het
Ndufv2 G T 17: 66,080,821 P119T probably damaging Het
Noc4l G A 5: 110,652,375 R95* probably null Het
Ntng1 A T 3: 110,135,503 Y2* probably null Het
Olfr1333 A T 4: 118,829,825 V205D possibly damaging Het
Olfr1423 C T 19: 12,036,161 V194I probably benign Het
Olfr1505 C T 19: 13,919,509 T163I probably benign Het
Olfr804 A G 10: 129,705,769 E297G possibly damaging Het
Oog4 T C 4: 143,439,203 N53D probably benign Het
Phkg2 T G 7: 127,573,903 L11R probably damaging Het
Pogz A G 3: 94,870,113 D368G probably damaging Het
Prex2 T A 1: 11,285,065 L1530Q probably damaging Het
Prmt1 C T 7: 44,979,454 E144K probably damaging Het
Prss8 T A 7: 127,927,176 I121F probably benign Het
Psmd13 T C 7: 140,897,711 L314P probably damaging Het
Ptch2 G A 4: 117,108,884 G467D probably damaging Het
Rbm20 C A 19: 53,864,165 P1192Q probably damaging Het
Rpl19 T A 11: 98,028,374 D45E probably benign Het
Rsph10b C T 5: 143,967,128 A219V probably damaging Het
Rtraf C T 14: 19,814,532 probably null Het
Scaf1 T A 7: 45,008,751 T235S probably damaging Het
Shank1 T A 7: 44,319,170 C296S unknown Het
Slc39a7 A T 17: 34,028,950 V426D probably damaging Het
Slc41a2 A T 10: 83,283,746 V384D probably damaging Het
Slco1c1 T C 6: 141,559,773 L475P probably benign Het
Slco6d1 A C 1: 98,490,634 K515T probably benign Het
Sos2 T C 12: 69,635,685 E253G probably damaging Het
Sp6 G T 11: 97,021,535 D25Y possibly damaging Het
Syt11 A C 3: 88,762,548 D12E possibly damaging Het
Taf2 A G 15: 55,047,460 L606P probably damaging Het
Tbc1d5 A G 17: 50,966,736 Y116H probably damaging Het
Tnfrsf8 A G 4: 145,288,459 I243T possibly damaging Het
Tnxb A G 17: 34,698,179 S2183G probably benign Het
Trim66 T C 7: 109,460,172 Y853C probably benign Het
Ttn T A 2: 76,737,495 T27685S probably damaging Het
Ttn T C 2: 76,743,122 E25809G probably damaging Het
Uvssa G A 5: 33,408,847 G445S probably benign Het
Zfp326 T C 5: 105,910,275 S427P probably damaging Het
Zfp592 A G 7: 81,024,889 T534A possibly damaging Het
Zfp672 A G 11: 58,316,347 S383P possibly damaging Het
Zfp799 A G 17: 32,820,726 S188P possibly damaging Het
Zyg11b A C 4: 108,272,253 V54G possibly damaging Het
Other mutations in Itgad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Itgad APN 7 128203850 missense probably damaging 0.99
IGL02036:Itgad APN 7 128189821 missense possibly damaging 0.49
IGL02589:Itgad APN 7 128181711 missense probably damaging 1.00
IGL02648:Itgad APN 7 128183374 intron probably benign
IGL02735:Itgad APN 7 128193716 missense probably damaging 1.00
IGL03088:Itgad APN 7 128203032 missense probably benign 0.01
IGL03110:Itgad APN 7 128185985 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0060:Itgad UTSW 7 128202986 missense probably damaging 1.00
R0184:Itgad UTSW 7 128189231 missense probably benign 0.02
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0211:Itgad UTSW 7 128204641 missense probably damaging 1.00
R0282:Itgad UTSW 7 128189978 splice site probably benign
R0646:Itgad UTSW 7 128174004 missense possibly damaging 0.89
R0947:Itgad UTSW 7 128175693 missense probably benign 0.08
R1439:Itgad UTSW 7 128183006 missense probably benign 0.44
R1454:Itgad UTSW 7 128192137 missense probably benign 0.02
R1503:Itgad UTSW 7 128198121 missense probably benign 0.00
R1531:Itgad UTSW 7 128178370 missense probably benign 0.00
R1572:Itgad UTSW 7 128203234 missense probably damaging 1.00
R1602:Itgad UTSW 7 128190939 missense probably damaging 1.00
R1732:Itgad UTSW 7 128205107 missense probably benign
R2278:Itgad UTSW 7 128205170 missense possibly damaging 0.93
R2851:Itgad UTSW 7 128204560 missense probably benign 0.01
R3029:Itgad UTSW 7 128178371 missense possibly damaging 0.85
R3080:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R3150:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3176:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3177:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3276:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3277:Itgad UTSW 7 128190981 missense possibly damaging 0.64
R3833:Itgad UTSW 7 128186233 missense probably damaging 1.00
R4541:Itgad UTSW 7 128198115 missense probably benign 0.13
R4649:Itgad UTSW 7 128189531 missense probably benign 0.01
R4753:Itgad UTSW 7 128223703 makesense probably null
R4852:Itgad UTSW 7 128198530 missense probably damaging 1.00
R4931:Itgad UTSW 7 128204625 missense probably damaging 1.00
R4970:Itgad UTSW 7 128189843 missense possibly damaging 0.70
R5116:Itgad UTSW 7 128203893 missense probably damaging 1.00
R5183:Itgad UTSW 7 128198223 critical splice donor site probably null
R5233:Itgad UTSW 7 128193428 splice site probably null
R5334:Itgad UTSW 7 128189286 missense probably damaging 0.99
R5731:Itgad UTSW 7 128198554 missense probably benign 0.19
R5760:Itgad UTSW 7 128203365 missense probably benign 0.02
R5896:Itgad UTSW 7 128174016 missense probably benign 0.34
R5955:Itgad UTSW 7 128189481 missense probably benign 0.00
R6247:Itgad UTSW 7 128185787 missense possibly damaging 0.48
R6659:Itgad UTSW 7 128185948 missense probably damaging 1.00
R7027:Itgad UTSW 7 128182989 missense probably damaging 1.00
R7104:Itgad UTSW 7 128198378 missense probably benign 0.00
R7120:Itgad UTSW 7 128173974 start codon destroyed probably null 0.02
R7272:Itgad UTSW 7 128205073 missense probably damaging 1.00
R7303:Itgad UTSW 7 128190179 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAGCATCAATCACCCCATCTTCCG -3'
(R):5'- CAAAGAGCCAGCTAAGAGGTTCCC -3'

Sequencing Primer
(F):5'- TCTTCCGAGAAGGTGCCAAG -3'
(R):5'- GGTATAGACCGTGTACTTCACCG -3'
Posted On2013-04-16