Incidental Mutation 'R3710:Rps17'
ID259545
Institutional Source Beutler Lab
Gene Symbol Rps17
Ensembl Gene ENSMUSG00000061787
Gene Nameribosomal protein S17
Synonyms
MMRRC Submission 040703-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R3710 (G1)
Quality Score195
Status Validated
Chromosome7
Chromosomal Location81342732-81345254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 81344924 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 30 (T30S)
Ref Sequence ENSEMBL: ENSMUSP00000079628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080813] [ENSMUST00000098331] [ENSMUST00000130310] [ENSMUST00000178892]
Predicted Effect probably benign
Transcript: ENSMUST00000080813
AA Change: T30S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000079628
Gene: ENSMUSG00000061787
AA Change: T30S

DomainStartEndE-ValueType
Pfam:Ribosomal_S17e 1 119 9.7e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098331
SMART Domains Protein: ENSMUSP00000095936
Gene: ENSMUSG00000025586

DomainStartEndE-ValueType
low complexity region 112 126 N/A INTRINSIC
low complexity region 176 195 N/A INTRINSIC
RRM 311 386 2.6e-4 SMART
RRM_2 430 506 2.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130310
SMART Domains Protein: ENSMUSP00000120139
Gene: ENSMUSG00000025586

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 171 190 N/A INTRINSIC
RRM 306 376 1.35e-1 SMART
RRM 420 496 6.36e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156346
Predicted Effect probably benign
Transcript: ENSMUST00000178892
SMART Domains Protein: ENSMUSP00000137079
Gene: ENSMUSG00000025586

DomainStartEndE-ValueType
Pfam:CEBP1_N 1 307 2.5e-153 PFAM
RRM 312 387 6.25e-2 SMART
RRM 431 507 6.36e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208054
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S17E family of ribosomal proteins and is located in the cytoplasm. Mutations in this gene cause Diamond-Blackfan anemia 4. Alternative splicing of this gene results in multiple transcript variants. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,725,535 probably benign Het
Agbl2 G A 2: 90,805,808 D563N probably benign Het
Aida C A 1: 183,304,675 probably null Het
Ank1 A G 8: 23,087,079 D200G probably damaging Het
Ankrd28 A G 14: 31,748,851 probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Atrnl1 C A 19: 57,657,114 H469N probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bud23 A C 5: 135,056,350 S41A possibly damaging Het
Car12 G T 9: 66,750,978 A21S probably damaging Het
Cav3 T A 6: 112,459,813 M1K probably null Het
Cdc42bpa A G 1: 180,065,063 D264G probably damaging Het
Cic A G 7: 25,286,981 D1276G probably damaging Het
Col2a1 A G 15: 97,990,907 probably benign Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Csn3 C A 5: 87,930,023 N129K possibly damaging Het
Diaph1 C A 18: 37,845,484 G1209W probably damaging Het
Dsg2 A G 18: 20,602,117 T1051A probably damaging Het
Gm1965 A T 6: 89,145,425 noncoding transcript Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsto1 T C 19: 47,859,532 probably null Het
Il15ra G T 2: 11,730,647 probably null Het
Ipo8 A T 6: 148,806,344 probably null Het
Lsm14a T A 7: 34,353,779 I283F probably damaging Het
Mael T C 1: 166,238,566 D34G probably damaging Het
March6 A T 15: 31,509,826 probably benign Het
Mtmr10 C A 7: 64,326,685 A410D possibly damaging Het
Myh9 T C 15: 77,773,347 E1066G possibly damaging Het
Nim1k A G 13: 119,712,099 S420P probably benign Het
Nlrp4c T A 7: 6,065,628 V176E probably damaging Het
Ogfod1 A T 8: 94,057,752 K313* probably null Het
Olfr1434 T G 19: 12,283,086 F13V probably damaging Het
Osbpl10 C A 9: 115,207,587 P253Q probably benign Het
Otof A T 5: 30,385,266 M661K probably benign Het
Rbms2 C T 10: 128,143,443 R139Q probably damaging Het
Rimbp2 G A 5: 128,789,731 T508I probably benign Het
Ros1 A T 10: 52,161,895 C393* probably null Het
Rps3 T C 7: 99,479,419 K197R probably benign Het
Samd11 G A 4: 156,250,495 L109F probably damaging Het
Smarca2 T G 19: 26,668,890 probably benign Het
Sprr2g C A 3: 92,374,729 P30Q unknown Het
Spz1 G A 13: 92,575,123 Q282* probably null Het
Syne3 A G 12: 104,943,438 L713P possibly damaging Het
Tgm1 C A 14: 55,712,595 probably benign Het
Tomm22 T C 15: 79,671,218 F55L probably damaging Het
Tph2 T A 10: 115,174,058 Y199F probably benign Het
Vmn2r108 A T 17: 20,462,670 F757L probably benign Het
Vmn2r69 T A 7: 85,406,393 T846S probably benign Het
Was G T X: 8,086,688 S271R probably benign Het
Zc3hav1 A C 6: 38,332,162 M575R probably benign Het
Other mutations in Rps17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1340:Rps17 UTSW 7 81343733 critical splice donor site probably null
R2268:Rps17 UTSW 7 81344998 missense probably benign 0.00
R7353:Rps17 UTSW 7 81344345 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTAAGGAGCCCGAACTAAGACC -3'
(R):5'- CGCCAACATGGTAGGTGTTTG -3'

Sequencing Primer
(F):5'- GTCGGCAAAACCCCACTGTG -3'
(R):5'- CAACATGGTAGGTGTTTGGCTCC -3'
Posted On2015-01-23