Incidental Mutation 'R3710:Was'
ID 259576
Institutional Source Beutler Lab
Gene Symbol Was
Ensembl Gene ENSMUSG00000031165
Gene Name Wiskott-Aldrich syndrome
Synonyms U42471, Wasp
MMRRC Submission 040703-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R3710 (G1)
Quality Score 222
Status Validated
Chromosome X
Chromosomal Location 7947705-7956730 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 7952927 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 271 (S271R)
Ref Sequence ENSEMBL: ENSMUSP00000033505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033505]
AlphaFold P70315
Predicted Effect probably benign
Transcript: ENSMUST00000033505
AA Change: S271R

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033505
Gene: ENSMUSG00000031165
AA Change: S271R

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
WH1 41 147 5.3e-42 SMART
low complexity region 174 200 N/A INTRINSIC
low complexity region 227 237 N/A INTRINSIC
PBD 240 276 2.71e-10 SMART
low complexity region 314 321 N/A INTRINSIC
WH2 448 465 6.55e-5 SMART
SCOP:d1ej5a_ 478 510 4e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157586
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Wiskott-Aldrich syndrome (WAS) family of proteins share similar domain structure, and are involved in transduction of signals from receptors on the cell surface to the actin cytoskeleton. The presence of a number of different motifs suggests that they are regulated by a number of different stimuli, and interact with multiple proteins. Recent studies have demonstrated that these proteins, directly or indirectly, associate with the small GTPase, Cdc42, known to regulate formation of actin filaments, and the cytoskeletal organizing complex, Arp2/3. Wiskott-Aldrich syndrome is a rare, inherited, X-linked, recessive disease characterized by immune dysregulation and microthrombocytopenia, and is caused by mutations in the WAS gene. The WAS gene product is a cytoplasmic protein, expressed exclusively in hematopoietic cells, which show signalling and cytoskeletal abnormalities in WAS patients. A transcript variant arising as a result of alternative promoter usage, and containing a different 5' UTR sequence, has been described, however, its full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant females and hemizygous mutant males exhibit reduced numbers of peripheral blood lymphocytes and platelets, but increased numbers of neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,597,384 (GRCm39) probably benign Het
Agbl2 G A 2: 90,636,152 (GRCm39) D563N probably benign Het
Aida C A 1: 183,085,610 (GRCm39) probably null Het
Ank1 A G 8: 23,577,095 (GRCm39) D200G probably damaging Het
Ankrd28 A G 14: 31,470,808 (GRCm39) probably benign Het
Ap3b2 C T 7: 81,123,598 (GRCm39) probably benign Het
Atrnl1 C A 19: 57,645,546 (GRCm39) H469N probably damaging Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Bud23 A C 5: 135,085,204 (GRCm39) S41A possibly damaging Het
Car12 G T 9: 66,658,260 (GRCm39) A21S probably damaging Het
Cav3 T A 6: 112,436,774 (GRCm39) M1K probably null Het
Cdc42bpa A G 1: 179,892,628 (GRCm39) D264G probably damaging Het
Cic A G 7: 24,986,406 (GRCm39) D1276G probably damaging Het
Col2a1 A G 15: 97,888,788 (GRCm39) probably benign Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Csn3 C A 5: 88,077,882 (GRCm39) N129K possibly damaging Het
Diaph1 C A 18: 37,978,537 (GRCm39) G1209W probably damaging Het
Dsg2 A G 18: 20,735,174 (GRCm39) T1051A probably damaging Het
Gm1965 A T 6: 89,122,407 (GRCm39) noncoding transcript Het
Gprc6a CAAA CA 10: 51,491,776 (GRCm39) probably null Het
Gsto1 T C 19: 47,847,971 (GRCm39) probably null Het
Il15ra G T 2: 11,735,458 (GRCm39) probably null Het
Ipo8 A T 6: 148,707,842 (GRCm39) probably null Het
Lsm14a T A 7: 34,053,204 (GRCm39) I283F probably damaging Het
Mael T C 1: 166,066,135 (GRCm39) D34G probably damaging Het
Marchf6 A T 15: 31,509,972 (GRCm39) probably benign Het
Mtmr10 C A 7: 63,976,433 (GRCm39) A410D possibly damaging Het
Myh9 T C 15: 77,657,547 (GRCm39) E1066G possibly damaging Het
Nim1k A G 13: 120,173,635 (GRCm39) S420P probably benign Het
Nlrp4c T A 7: 6,068,627 (GRCm39) V176E probably damaging Het
Ogfod1 A T 8: 94,784,380 (GRCm39) K313* probably null Het
Or5an1 T G 19: 12,260,450 (GRCm39) F13V probably damaging Het
Osbpl10 C A 9: 115,036,655 (GRCm39) P253Q probably benign Het
Otof A T 5: 30,542,610 (GRCm39) M661K probably benign Het
Rbms2 C T 10: 127,979,312 (GRCm39) R139Q probably damaging Het
Rimbp2 G A 5: 128,866,795 (GRCm39) T508I probably benign Het
Ros1 A T 10: 52,037,991 (GRCm39) C393* probably null Het
Rps17 T A 7: 80,994,672 (GRCm39) T30S probably benign Het
Rps3 T C 7: 99,128,626 (GRCm39) K197R probably benign Het
Samd11 G A 4: 156,334,952 (GRCm39) L109F probably damaging Het
Smarca2 T G 19: 26,646,290 (GRCm39) probably benign Het
Sprr2g C A 3: 92,282,036 (GRCm39) P30Q unknown Het
Spz1 G A 13: 92,711,631 (GRCm39) Q282* probably null Het
Syne3 A G 12: 104,909,697 (GRCm39) L713P possibly damaging Het
Tgm1 C A 14: 55,950,052 (GRCm39) probably benign Het
Tomm22 T C 15: 79,555,419 (GRCm39) F55L probably damaging Het
Tph2 T A 10: 115,009,963 (GRCm39) Y199F probably benign Het
Vmn2r108 A T 17: 20,682,932 (GRCm39) F757L probably benign Het
Vmn2r69 T A 7: 85,055,601 (GRCm39) T846S probably benign Het
Zc3hav1 A C 6: 38,309,097 (GRCm39) M575R probably benign Het
Other mutations in Was
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Was APN X 7,954,055 (GRCm39) missense probably damaging 1.00
IGL02100:Was APN X 7,956,554 (GRCm39) missense possibly damaging 0.54
R3709:Was UTSW X 7,952,927 (GRCm39) missense probably benign 0.05
R6818:Was UTSW X 7,952,450 (GRCm39) small deletion probably benign
R7601:Was UTSW X 7,952,450 (GRCm39) small deletion probably benign
RF012:Was UTSW X 7,952,470 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGGTAAAATGACATTTATGTGTGC -3'
(R):5'- ATTGACCAAGGCTCAGAGC -3'

Sequencing Primer
(F):5'- ACTTTGTAGACCAGGCTGAC -3'
(R):5'- GCTCAGAGCCCATATCCAG -3'
Posted On 2015-01-23