Incidental Mutation 'R3115:Zfp81'
ID264000
Institutional Source Beutler Lab
Gene Symbol Zfp81
Ensembl Gene ENSMUSG00000003929
Gene Namezinc finger protein 81
SynonymsKRAB13, Zfp78, Hszfp36, C330034P10Rik, D330034E10Rik
MMRRC Submission 040588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R3115 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33329342-33358878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33334563 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 426 (A426T)
Ref Sequence ENSEMBL: ENSMUSP00000050728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054072]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054072
AA Change: A426T

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000050728
Gene: ENSMUSG00000003929
AA Change: A426T

DomainStartEndE-ValueType
KRAB 4 55 1.15e-14 SMART
ZnF_C2H2 222 244 1.04e-3 SMART
ZnF_C2H2 250 272 1.53e-1 SMART
ZnF_C2H2 278 300 1.33e-1 SMART
ZnF_C2H2 306 328 5.21e-4 SMART
ZnF_C2H2 334 356 2.2e-2 SMART
ZnF_C2H2 362 384 1.58e-3 SMART
ZnF_C2H2 390 412 1.64e-1 SMART
ZnF_C2H2 418 440 7.67e-2 SMART
ZnF_C2H2 446 468 1.89e-1 SMART
ZnF_C2H2 474 496 2.86e-1 SMART
ZnF_C2H2 502 524 1.08e-1 SMART
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,540,024 probably null Het
Abcc9 T C 6: 142,689,029 T170A probably benign Het
Agbl2 T C 2: 90,805,901 S594P possibly damaging Het
Atf7 C T 15: 102,534,423 S417N probably benign Het
C130026I21Rik C G 1: 85,257,385 probably benign Het
Cacng7 T C 7: 3,338,934 V111A probably benign Het
Chrm4 A G 2: 91,927,360 T38A probably benign Het
Cnot1 T C 8: 95,744,278 E1314G possibly damaging Het
Dcx A G X: 143,923,109 Y229H probably damaging Het
Espl1 T A 15: 102,323,204 F1945Y possibly damaging Het
Glul T C 1: 153,907,292 F204L possibly damaging Het
Gm597 A C 1: 28,776,329 V874G possibly damaging Het
Grm2 A G 9: 106,647,623 V631A probably damaging Het
Ifi205 T A 1: 174,028,335 Y43F possibly damaging Het
Irs3 A G 5: 137,643,856 L440P probably benign Het
Itpr1 A G 6: 108,406,109 D1466G possibly damaging Het
Jarid2 T C 13: 44,896,466 S257P probably damaging Het
Knl1 C A 2: 119,070,391 L858M possibly damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Lrriq1 C T 10: 103,170,433 R1277Q probably benign Het
Mgp A C 6: 136,872,685 Y92D probably damaging Het
Micu3 A G 8: 40,382,167 H521R probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Mprip T A 11: 59,765,403 probably null Het
Mybph A G 1: 134,194,738 I174V probably benign Het
Mynn C T 3: 30,607,810 T347M probably damaging Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nr1d2 A T 14: 18,215,504 probably null Het
Olfr1512 T C 14: 52,372,940 T38A probably damaging Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Pcdha4 T C 18: 36,953,550 V262A probably benign Het
Pde4d T A 13: 109,948,258 M519K probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prdx4 C T X: 155,330,411 R167Q probably damaging Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Prph T A 15: 99,055,456 F84I probably damaging Het
Rnmt A G 18: 68,314,008 E321G probably benign Het
Serpinb13 A T 1: 106,982,838 E64V probably null Het
Slc12a4 A T 8: 105,959,459 S81T probably damaging Het
Slc47a1 A G 11: 61,367,680 L179P possibly damaging Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Sycp2l C A 13: 41,148,798 T456K probably benign Het
Tenm2 A G 11: 36,023,366 L2447P probably damaging Het
Tll1 A G 8: 64,053,866 C614R probably damaging Het
Usp5 T C 6: 124,815,597 Y826C probably damaging Het
Vmn2r71 A C 7: 85,623,658 D560A probably damaging Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zscan22 T C 7: 12,907,290 I328T probably benign Het
Other mutations in Zfp81
AlleleSourceChrCoordTypePredicted EffectPPH Score
feuer UTSW 17 33334333 nonsense probably null
R0143:Zfp81 UTSW 17 33335121 missense possibly damaging 0.85
R0220:Zfp81 UTSW 17 33336724 missense possibly damaging 0.93
R0520:Zfp81 UTSW 17 33334377 missense probably damaging 0.97
R0611:Zfp81 UTSW 17 33334619 missense probably benign 0.02
R1171:Zfp81 UTSW 17 33335280 missense probably benign
R1613:Zfp81 UTSW 17 33334783 missense probably damaging 0.98
R1779:Zfp81 UTSW 17 33335106 missense probably benign 0.06
R1970:Zfp81 UTSW 17 33335501 missense probably benign
R2063:Zfp81 UTSW 17 33335304 missense probably benign 0.03
R2314:Zfp81 UTSW 17 33334623 missense probably damaging 0.99
R2898:Zfp81 UTSW 17 33334300 nonsense probably null
R4207:Zfp81 UTSW 17 33334916 missense probably damaging 1.00
R4497:Zfp81 UTSW 17 33334703 missense possibly damaging 0.47
R4498:Zfp81 UTSW 17 33334703 missense possibly damaging 0.47
R5756:Zfp81 UTSW 17 33334333 nonsense probably null
R5964:Zfp81 UTSW 17 33336845 missense probably damaging 0.99
R6671:Zfp81 UTSW 17 33335439 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACATTGGTATAAGTTCTACCCACTAG -3'
(R):5'- ATGTAGTTATGGTCAGTCATATGAAAG -3'

Sequencing Primer
(F):5'- GTAGAACATGTGAAGGCTTTCCCAC -3'
(R):5'- TCCAAGGGCCTGTTATAACCATG -3'
Posted On2015-02-05