Incidental Mutation 'R3149:Hoxa13'
ID264347
Institutional Source Beutler Lab
Gene Symbol Hoxa13
Ensembl Gene ENSMUSG00000038203
Gene Namehomeobox A13
SynonymsHox-1.10
MMRRC Submission 040601-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3149 (G1)
Quality Score95
Status Not validated
Chromosome6
Chromosomal Location52257694-52260880 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 52260304 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047993] [ENSMUST00000114416] [ENSMUST00000147595]
Predicted Effect unknown
Transcript: ENSMUST00000047993
AA Change: A156E
SMART Domains Protein: ENSMUSP00000039170
Gene: ENSMUSG00000038203
AA Change: A156E

DomainStartEndE-ValueType
low complexity region 37 81 N/A INTRINSIC
Pfam:HoxA13_N 136 219 6.2e-25 PFAM
HOX 317 379 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114416
SMART Domains Protein: ENSMUSP00000110059
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 55 1e-19 PFAM
HOX 153 215 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141300
Predicted Effect unknown
Transcript: ENSMUST00000147595
AA Change: A69E
SMART Domains Protein: ENSMUSP00000125221
Gene: ENSMUSG00000038203
AA Change: A69E

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 39 8.3e-11 PFAM
HOX 137 199 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192253
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Expansion of a polyalanine tract in the encoded protein can cause hand-foot-uterus syndrome, also known as hand-foot-genital syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit agenesis of both the urinary bladder and the caudal portion of the Mullerian ducts, premature stenosis of the umbilical arteries, loss of the most anterior digit of all feet, and death around mid-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik G A 17: 56,876,348 A30T probably benign Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Cel T C 2: 28,556,131 D576G probably benign Het
Csf2ra C A 19: 61,227,320 A16S possibly damaging Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dus1l T C 11: 120,793,104 T173A possibly damaging Het
Dzip1 T C 14: 118,911,368 T300A probably benign Het
Fam208b G A 13: 3,574,359 P1182S probably damaging Het
Ggta1 A T 2: 35,402,623 I224N probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5150 A G 3: 16,006,315 L3P probably damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7137 T C 10: 77,788,005 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Ift46 A G 9: 44,783,748 D65G probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mapk11 T C 15: 89,145,450 probably null Het
Mettl25 T C 10: 105,826,353 D252G probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Pecam1 A G 11: 106,684,281 V601A possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rassf9 A T 10: 102,544,826 D21V possibly damaging Het
Rmnd5a T A 6: 71,429,101 I68L probably benign Het
Rock2 T C 12: 16,965,091 S762P probably damaging Het
Srgap2 T C 1: 131,292,589 T216A probably benign Het
Vmn1r86 T A 7: 13,102,431 K123* probably null Het
Vmn2r68 A C 7: 85,237,667 V13G probably benign Het
Vps13d G C 4: 145,126,577 N2322K possibly damaging Het
Xpo5 A G 17: 46,242,247 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Hoxa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8786:Hoxa13 UTSW 6 52260636 frame shift probably null
PIT4131001:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
PIT4131001:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R0458:Hoxa13 UTSW 6 52260635 frame shift probably null
R0496:Hoxa13 UTSW 6 52260635 frame shift probably null
R0502:Hoxa13 UTSW 6 52260635 frame shift probably null
R0512:Hoxa13 UTSW 6 52260635 frame shift probably null
R0784:Hoxa13 UTSW 6 52259937 missense probably damaging 0.98
R1062:Hoxa13 UTSW 6 52260635 frame shift probably null
R1157:Hoxa13 UTSW 6 52260635 frame shift probably null
R1192:Hoxa13 UTSW 6 52260635 frame shift probably null
R1310:Hoxa13 UTSW 6 52260635 frame shift probably null
R1341:Hoxa13 UTSW 6 52260635 frame shift probably null
R1343:Hoxa13 UTSW 6 52260635 frame shift probably null
R1398:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1398:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52260647 utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52260648 utr 5 prime probably benign
R1632:Hoxa13 UTSW 6 52259937 missense probably damaging 0.98
R2382:Hoxa13 UTSW 6 52259145 missense probably damaging 0.98
R4012:Hoxa13 UTSW 6 52259127 missense possibly damaging 0.47
R4426:Hoxa13 UTSW 6 52260729 utr 5 prime probably benign
R5535:Hoxa13 UTSW 6 52260540 frame shift probably null
R6175:Hoxa13 UTSW 6 52259928 missense probably damaging 0.98
R7365:Hoxa13 UTSW 6 52259882 missense probably damaging 1.00
X0018:Hoxa13 UTSW 6 52260119 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GAAAGCAAACTCCTTGGCG -3'
(R):5'- CGAGCTCAACAAGAACATGG -3'

Sequencing Primer
(F):5'- AAACTCCTTGGCGCGGGAG -3'
(R):5'- AGTGCCGCAACCTGATG -3'
Posted On2015-02-05