Incidental Mutation 'R3433:Rrbp1'
ID266274
Institutional Source Beutler Lab
Gene Symbol Rrbp1
Ensembl Gene ENSMUSG00000027422
Gene Nameribosome binding protein 1
SynonymsmRRp15b, mRRp47, mRRp41, 5730465C04Rik, 1700087N07Rik, mRRp0, mRRp15a, mRRp16.8, mRRp10, mRRp5.4, ES/130, mRRp2, mRRp1.8, p180
MMRRC Submission 040651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R3433 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location143947395-144011263 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 143952280 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000016072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016072]
Predicted Effect probably benign
Transcript: ENSMUST00000016072
SMART Domains Protein: ENSMUSP00000016072
Gene: ENSMUSG00000027422

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Rib_recp_KP_reg 33 171 2.3e-40 PFAM
low complexity region 197 215 N/A INTRINSIC
internal_repeat_2 218 373 2.94e-114 PROSPERO
internal_repeat_1 219 406 7.79e-148 PROSPERO
internal_repeat_1 410 618 7.79e-148 PROSPERO
internal_repeat_2 449 692 2.94e-114 PROSPERO
coiled coil region 757 1126 N/A INTRINSIC
coiled coil region 1167 1321 N/A INTRINSIC
coiled coil region 1342 1455 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155539
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,294,232 W1302R probably damaging Het
Abcf1 A G 17: 35,958,217 Y689H probably benign Het
Adamtsl5 T C 10: 80,342,891 T218A probably benign Het
Ahnak G T 19: 9,009,994 V2881L probably benign Het
Atp6v1b1 C A 6: 83,743,092 T3K possibly damaging Het
Atp8b5 A T 4: 43,372,697 R1112S probably benign Het
Carmil3 A G 14: 55,507,694 D1331G probably benign Het
Catsperg2 A G 7: 29,701,218 F696S possibly damaging Het
Cd33 T C 7: 43,529,907 T273A probably benign Het
Cenpf C T 1: 189,659,949 C562Y probably damaging Het
Cep192 A G 18: 67,834,892 R816G probably benign Het
Cnot11 G A 1: 39,545,187 probably null Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Dnah9 T C 11: 66,075,112 M1693V possibly damaging Het
Fbxo41 A G 6: 85,477,631 I701T probably damaging Het
Figla G T 6: 86,017,429 R62L probably damaging Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10845 C T 14: 79,863,411 noncoding transcript Het
Gm5114 T C 7: 39,409,197 K333E probably benign Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Il6st A G 13: 112,503,831 K653E probably damaging Het
Kansl2 A G 15: 98,528,861 probably null Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Leng8 C A 7: 4,142,132 T177K probably benign Het
Lrrtm2 A C 18: 35,213,897 S117R probably damaging Het
Megf8 G T 7: 25,360,124 A2285S probably benign Het
Meiob T C 17: 24,816,597 probably benign Het
Myo18a G T 11: 77,818,044 probably null Het
Nars A T 18: 64,509,303 M156K probably damaging Het
Ndor1 A G 2: 25,247,811 S499P possibly damaging Het
Olfr1251 T C 2: 89,667,233 I218V probably benign Het
Olfr458 G A 6: 42,460,954 H22Y probably benign Het
Olfr47 A T 6: 43,235,673 I22F probably damaging Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Ptprd C A 4: 76,086,011 probably null Het
Ros1 A G 10: 52,091,108 Y1668H probably benign Het
Rtn4rl2 T C 2: 84,872,100 Y376C probably damaging Het
Seh1l A C 18: 67,793,152 K358T probably benign Het
Sema3e A T 5: 14,252,714 Y751F probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Spred2 G T 11: 19,998,277 E91* probably null Het
Sspo A T 6: 48,475,951 probably null Het
Tcaf1 A G 6: 42,686,574 V124A probably damaging Het
Tnks1bp1 T C 2: 85,071,016 probably benign Het
Txndc11 T C 16: 11,088,188 T493A probably benign Het
Usp17lb T A 7: 104,841,648 Q23L possibly damaging Het
Vgf T C 5: 137,031,019 F12L probably benign Het
Zfp13 G A 17: 23,576,628 T323I probably damaging Het
Other mutations in Rrbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Rrbp1 APN 2 143968618 missense possibly damaging 0.93
IGL01636:Rrbp1 APN 2 143947895 unclassified probably benign
IGL01923:Rrbp1 APN 2 143990161 missense probably damaging 1.00
IGL02513:Rrbp1 APN 2 143988430 missense possibly damaging 0.55
IGL02548:Rrbp1 APN 2 143949759 splice site probably benign
IGL02678:Rrbp1 APN 2 143990187 missense probably damaging 0.98
FR4449:Rrbp1 UTSW 2 143967456 frame shift probably null
PIT4378001:Rrbp1 UTSW 2 143974540 missense probably benign 0.00
R0127:Rrbp1 UTSW 2 143989944 missense probably benign 0.21
R0611:Rrbp1 UTSW 2 143988516 missense probably damaging 1.00
R0881:Rrbp1 UTSW 2 143953253 missense probably benign 0.09
R1439:Rrbp1 UTSW 2 143955112 critical splice donor site probably null
R1534:Rrbp1 UTSW 2 143988313 missense probably damaging 1.00
R1604:Rrbp1 UTSW 2 143989390 missense probably damaging 0.99
R1920:Rrbp1 UTSW 2 143988291 missense probably benign 0.16
R1921:Rrbp1 UTSW 2 143988291 missense probably benign 0.16
R2152:Rrbp1 UTSW 2 143954198 missense possibly damaging 0.75
R2153:Rrbp1 UTSW 2 143954198 missense possibly damaging 0.75
R2319:Rrbp1 UTSW 2 143957559 missense probably benign 0.01
R2850:Rrbp1 UTSW 2 143949349 missense probably benign 0.09
R2864:Rrbp1 UTSW 2 143957637 missense probably damaging 0.99
R3707:Rrbp1 UTSW 2 143953277 missense probably benign 0.01
R3837:Rrbp1 UTSW 2 143989558 missense probably damaging 1.00
R4073:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4074:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4076:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4279:Rrbp1 UTSW 2 143963108 missense probably benign 0.16
R4583:Rrbp1 UTSW 2 143988751 missense probably benign 0.03
R4820:Rrbp1 UTSW 2 143964765 missense possibly damaging 0.78
R4829:Rrbp1 UTSW 2 143989687 missense probably benign 0.18
R4836:Rrbp1 UTSW 2 143988417 missense possibly damaging 0.75
R5589:Rrbp1 UTSW 2 143989966 missense probably benign 0.16
R5801:Rrbp1 UTSW 2 143989783 missense probably damaging 1.00
R5806:Rrbp1 UTSW 2 143963331 missense probably benign 0.16
R5955:Rrbp1 UTSW 2 143949677 missense probably benign 0.06
R6102:Rrbp1 UTSW 2 143988393 missense probably damaging 1.00
R6368:Rrbp1 UTSW 2 143989555 missense probably damaging 1.00
R6916:Rrbp1 UTSW 2 143974598 missense probably benign 0.03
R7022:Rrbp1 UTSW 2 143957802 intron probably null
R7061:Rrbp1 UTSW 2 143989167 missense possibly damaging 0.61
R7136:Rrbp1 UTSW 2 143949680 missense probably benign 0.16
R7291:Rrbp1 UTSW 2 143969462 missense probably benign 0.09
Z1088:Rrbp1 UTSW 2 143974486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAAGCTGCAGACACTCC -3'
(R):5'- CATGAGACAATGGGCAGGTGTC -3'

Sequencing Primer
(F):5'- GCTGCAGACACTCCACATGG -3'
(R):5'- GGTGTGAACTTCTGAGACATCAAACC -3'
Posted On2015-02-18